View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11379_low_83 (Length: 240)
Name: NF11379_low_83
Description: NF11379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11379_low_83 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 17 - 240
Target Start/End: Original strand, 41711887 - 41712106
Alignment:
| Q |
17 |
aatttaatctacctttatgatgattgatatatagtatttagtaaatctagtaatataaggttgtttggctgatagccgcatgggttggggaatgagtata |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| | ||||||||||||||||||||||||||||| |
|
|
| T |
41711887 |
aatttaatctacctttatgatgattgatatatagtatttagtaaatctagttatataaggttgtgag----atagccgcatgggttggggaatgagtata |
41711982 |
T |
 |
| Q |
117 |
aaaaaccagggttgtgacaccatcttcagtaaatgtaaaattgagcttgagttgagcatatcgaaattgaatcaatcttcgatgaaggttggggttgaga |
216 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41711983 |
aaaaaccagggttgtgacactatcttcagtaaatgtaaaattgagcttgagttgagcatatcgaaattgaatcaatcttcgatgaaggttggggttgaga |
41712082 |
T |
 |
| Q |
217 |
tggggaattcaaactgttattgat |
240 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
41712083 |
tggggaattcaaactgttattgat |
41712106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University