View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11379_low_85 (Length: 230)

Name: NF11379_low_85
Description: NF11379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11379_low_85
NF11379_low_85
[»] chr1 (2 HSPs)
chr1 (1-120)||(52166884-52167003)
chr1 (158-220)||(52166730-52166792)
[»] chr2 (1 HSPs)
chr2 (180-220)||(41782823-41782863)


Alignment Details
Target: chr1 (Bit Score: 96; Significance: 3e-47; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 1 - 120
Target Start/End: Complemental strand, 52167003 - 52166884
Alignment:
1 taacagatgcttgtccagtttcgaaatcaccaatcccaatagagtctacactaccagatgatctcttcaaaacagatttgctaaccggagtttcaaccat 100  Q
    |||||||||||||||||||||| |  ||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
52167003 taacagatgcttgtccagtttccacgtcaccaaccccaatagagtctacactaccagatgatctcttcaaagcagatttgctaaccggagtttcaaccat 52166904  T
101 gtttgtgtcgttgtatgagt 120  Q
    |||||||||| |||||||||    
52166903 gtttgtgtcgctgtatgagt 52166884  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 158 - 220
Target Start/End: Complemental strand, 52166792 - 52166730
Alignment:
158 gacaaaataccatcactctttttgggatccgaatcctctccagttttatctctcctgcctttg 220  Q
    ||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||    
52166792 gacaaaataccatcactctttttgggatccggatcctcttcagttttatctctcctgcctttg 52166730  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 180 - 220
Target Start/End: Complemental strand, 41782863 - 41782823
Alignment:
180 tgggatccgaatcctctccagttttatctctcctgcctttg 220  Q
    ||||||||| ||||||||| |||||||||||||||||||||    
41782863 tgggatccggatcctctcccgttttatctctcctgcctttg 41782823  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University