View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11379_low_86 (Length: 228)
Name: NF11379_low_86
Description: NF11379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11379_low_86 |
 | |
|
| [»] scaffold0062 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0062 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: scaffold0062
Description:
Target: scaffold0062; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 16 - 209
Target Start/End: Original strand, 5633 - 5826
Alignment:
| Q |
16 |
tagggcaagttataacagatctcaagaaagatagagatctgaatatcaatgttgtgtccattgctccatccgagcaaaatgattcgcattaccgcaaatt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5633 |
tagggcaagttataacagatctcaagaaagatagagatctgaatatcaatgttgtgtccattgctccatccgagcaaaatgattcgcattaccgcaaatt |
5732 |
T |
|
| Q |
116 |
gtattgggaaaacaaggacaatattaatttggttgactacaagttatacaaccaaactaaaattgtacaaacatctgaagaatttgtgaaactt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5733 |
gtattgggaaaacaaggacaatattaatttggttgactacaagttatacaaccaaactaaaattgtacaaacatctgaagaatttgtgaaactt |
5826 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University