View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1137_high_116 (Length: 286)
Name: NF1137_high_116
Description: NF1137
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1137_high_116 |
 |  |
|
| [»] scaffold0054 (1 HSPs) |
 |  |  |
|
| [»] scaffold1770 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr5 (Bit Score: 226; Significance: 1e-124; HSPs: 14)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 10 - 259
Target Start/End: Complemental strand, 37900665 - 37900416
Alignment:
| Q |
10 |
attattcttcaaaatggacaagtattatgaaacggagggagtattgaacatgactaaccacaattttgaatcgcgctaaacacattgtcaaattttaatt |
109 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37900665 |
attattcttcaaaatagacaagtattatgaaacggaaggagtattgaacatgactaaccacgattttgaatcgcgctaaacacattgtcaaattttaatt |
37900566 |
T |
 |
| Q |
110 |
gtttaaataacactaatgtgatagtctttaaactcatgatatatttaatatttcattttcttttttgtttcaaagagtgatgcggtgaaactcatccgcg |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37900565 |
gtttaaataacactaatgtgatagtctttaaactcatgatatgtttaatatttcattttcttttttgtttcaaagagtgatgcggtgaaactcatccgcg |
37900466 |
T |
 |
| Q |
210 |
tctcaacatataaaatatctatgcaattctttaccaaatgagctgtactt |
259 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
37900465 |
tctcaacatatgaaatatctatgcaattctttaccaaatgagttgtactt |
37900416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 10 - 52
Target Start/End: Complemental strand, 25683271 - 25683229
Alignment:
| Q |
10 |
attattcttcaaaatggacaagtattatgaaacggagggagta |
52 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
25683271 |
attattctccaaaatggacaagtattatgaaacggagggagta |
25683229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 10 - 55
Target Start/End: Complemental strand, 12806895 - 12806850
Alignment:
| Q |
10 |
attattcttcaaaatggacaagtattatgaaacggagggagtattg |
55 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
12806895 |
attattctctaaaatggacaagtattatgaaacggagggagtattg |
12806850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 10 - 53
Target Start/End: Complemental strand, 10285100 - 10285057
Alignment:
| Q |
10 |
attattcttcaaaatggacaagtattatgaaacggagggagtat |
53 |
Q |
| |
|
||||||||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
10285100 |
attattctttaaaatagacaagtattatgaaacggagggagtat |
10285057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 10 - 53
Target Start/End: Complemental strand, 23097766 - 23097723
Alignment:
| Q |
10 |
attattcttcaaaatggacaagtattatgaaacggagggagtat |
53 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||| ||||||| |
|
|
| T |
23097766 |
attattctccaaaatggacaagtattatgaaacggaaggagtat |
23097723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 10 - 53
Target Start/End: Complemental strand, 30720534 - 30720491
Alignment:
| Q |
10 |
attattcttcaaaatggacaagtattatgaaacggagggagtat |
53 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
30720534 |
attattctctaaaatggacaagtattatgaaacggagggagtat |
30720491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 10 - 52
Target Start/End: Complemental strand, 36561141 - 36561099
Alignment:
| Q |
10 |
attattcttcaaaatggacaagtattatgaaacggagggagta |
52 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
36561141 |
attattctctaaaatggacaagtattatgaaacggagggagta |
36561099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 10 - 52
Target Start/End: Complemental strand, 40886652 - 40886610
Alignment:
| Q |
10 |
attattcttcaaaatggacaagtattatgaaacggagggagta |
52 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
40886652 |
attattctctaaaatggacaagtattatgaaacggagggagta |
40886610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 14 - 54
Target Start/End: Original strand, 734576 - 734616
Alignment:
| Q |
14 |
ttcttcaaaatggacaagtattatgaaacggagggagtatt |
54 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
734576 |
ttcttcaaaatggacaagtattgtgaaacggagggaatatt |
734616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 14 - 53
Target Start/End: Complemental strand, 39070921 - 39070882
Alignment:
| Q |
14 |
ttcttcaaaatggacaagtattatgaaacggagggagtat |
53 |
Q |
| |
|
|||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
39070921 |
ttcttcaaaatgaacaagtattgtgaaacggagggagtat |
39070882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 10 - 52
Target Start/End: Complemental strand, 734381 - 734339
Alignment:
| Q |
10 |
attattcttcaaaatggacaagtattatgaaacggagggagta |
52 |
Q |
| |
|
|||||||| ||||||||||||||||| |||||||| ||||||| |
|
|
| T |
734381 |
attattctccaaaatggacaagtattgtgaaacggtgggagta |
734339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 11 - 53
Target Start/End: Original strand, 25773885 - 25773927
Alignment:
| Q |
11 |
ttattcttcaaaatggacaagtattatgaaacggagggagtat |
53 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
25773885 |
ttattctctaaaatggacaagtattatgaaacggagagagtat |
25773927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 14 - 54
Target Start/End: Complemental strand, 11319597 - 11319557
Alignment:
| Q |
14 |
ttcttcaaaatggacaagtattatgaaacggagggagtatt |
54 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||| |||||| |
|
|
| T |
11319597 |
ttcttcaaaatggacaaatattgtgaaacggaggaagtatt |
11319557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 10 - 50
Target Start/End: Original strand, 16983492 - 16983532
Alignment:
| Q |
10 |
attattcttcaaaatggacaagtattatgaaacggagggag |
50 |
Q |
| |
|
||||||||||||||| |||||||||||| |||| ||||||| |
|
|
| T |
16983492 |
attattcttcaaaatagacaagtattataaaacagagggag |
16983532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 44; Significance: 4e-16; HSPs: 15)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 10 - 53
Target Start/End: Original strand, 23526474 - 23526517
Alignment:
| Q |
10 |
attattcttcaaaatggacaagtattatgaaacggagggagtat |
53 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23526474 |
attattcttcaaaatggacaagtattatgaaacggagggagtat |
23526517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 10 - 54
Target Start/End: Original strand, 33082979 - 33083023
Alignment:
| Q |
10 |
attattcttcaaaatggacaagtattatgaaacggagggagtatt |
54 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
33082979 |
attattctttaaaatggacaagtattatgaaacggagggagtatt |
33083023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 10 - 54
Target Start/End: Original strand, 284568 - 284612
Alignment:
| Q |
10 |
attattcttcaaaatggacaagtattatgaaacggagggagtatt |
54 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
284568 |
attattctctaaaatggacaagtattatgaaacggagggagtatt |
284612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 10 - 54
Target Start/End: Complemental strand, 24771948 - 24771904
Alignment:
| Q |
10 |
attattcttcaaaatggacaagtattatgaaacggagggagtatt |
54 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
24771948 |
attattctctaaaatggacaagtattatgaaacggagggagtatt |
24771904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 10 - 54
Target Start/End: Complemental strand, 40783699 - 40783655
Alignment:
| Q |
10 |
attattcttcaaaatggacaagtattatgaaacggagggagtatt |
54 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
40783699 |
attattctctaaaatggacaagtattatgaaacggagggagtatt |
40783655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 10 - 52
Target Start/End: Complemental strand, 23045321 - 23045279
Alignment:
| Q |
10 |
attattcttcaaaatggacaagtattatgaaacggagggagta |
52 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
23045321 |
attattctctaaaatggacaagtattatgaaacggagggagta |
23045279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 10 - 52
Target Start/End: Complemental strand, 47037894 - 47037852
Alignment:
| Q |
10 |
attattcttcaaaatggacaagtattatgaaacggagggagta |
52 |
Q |
| |
|
||||||||| ||||| ||||||||||||||||||||||||||| |
|
|
| T |
47037894 |
attattctttaaaatagacaagtattatgaaacggagggagta |
47037852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 10 - 47
Target Start/End: Original strand, 46771873 - 46771910
Alignment:
| Q |
10 |
attattcttcaaaatggacaagtattatgaaacggagg |
47 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
46771873 |
attattcttcaaaatgaacaagtattatgaaacggagg |
46771910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 20 - 52
Target Start/End: Original strand, 321871 - 321903
Alignment:
| Q |
20 |
aaaatggacaagtattatgaaacggagggagta |
52 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
321871 |
aaaatggacaagtattatgaaacggagggagta |
321903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 14 - 52
Target Start/End: Original strand, 24772144 - 24772182
Alignment:
| Q |
14 |
ttcttcaaaatggacaagtattatgaaacggagggagta |
52 |
Q |
| |
|
|||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
24772144 |
ttcttcaaaatggacatgtattttgaaacggagggagta |
24772182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 14 - 52
Target Start/End: Original strand, 51064995 - 51065033
Alignment:
| Q |
14 |
ttcttcaaaatggacaagtattatgaaacggagggagta |
52 |
Q |
| |
|
||||| |||||||||||||||| |||||||||||||||| |
|
|
| T |
51064995 |
ttctttaaaatggacaagtattgtgaaacggagggagta |
51065033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 13 - 54
Target Start/End: Complemental strand, 40562325 - 40562284
Alignment:
| Q |
13 |
attcttcaaaatggacaagtattatgaaacggagggagtatt |
54 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| | |||||| |
|
|
| T |
40562325 |
attcttcaaaatggacaagtattataaaacggatgaagtatt |
40562284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 14 - 54
Target Start/End: Complemental strand, 9588708 - 9588668
Alignment:
| Q |
14 |
ttcttcaaaatggacaagtattatgaaacggagggagtatt |
54 |
Q |
| |
|
|||| ||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
9588708 |
ttctccaaaatggacatgtattttgaaacggagggagtatt |
9588668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 10 - 46
Target Start/End: Complemental strand, 27210997 - 27210961
Alignment:
| Q |
10 |
attattcttcaaaatggacaagtattatgaaacggag |
46 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
27210997 |
attattcttaaaaatggacaaatattatgaaacggag |
27210961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 14 - 54
Target Start/End: Complemental strand, 44227886 - 44227846
Alignment:
| Q |
14 |
ttcttcaaaatggacaagtattatgaaacggagggagtatt |
54 |
Q |
| |
|
|||| ||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
44227886 |
ttctccaaaatggacatgtattttgaaacggagggagtatt |
44227846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 10)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 10 - 54
Target Start/End: Complemental strand, 15064737 - 15064693
Alignment:
| Q |
10 |
attattcttcaaaatggacaagtattatgaaacggagggagtatt |
54 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
15064737 |
attattctccaaaatggacaagtattatgaaacggagggagtatt |
15064693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 10 - 53
Target Start/End: Original strand, 17942678 - 17942721
Alignment:
| Q |
10 |
attattcttcaaaatggacaagtattatgaaacggagggagtat |
53 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
17942678 |
attattctccaaaatggacaagtattatgaaacggagggagtat |
17942721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 10 - 54
Target Start/End: Original strand, 1605813 - 1605857
Alignment:
| Q |
10 |
attattcttcaaaatggacaagtattatgaaacggagggagtatt |
54 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
1605813 |
attattctctaaaatggacaagtattatgaaacggagggagtatt |
1605857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 10 - 54
Target Start/End: Original strand, 8626717 - 8626761
Alignment:
| Q |
10 |
attattcttcaaaatggacaagtattatgaaacggagggagtatt |
54 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
8626717 |
attattctctaaaatggacaagtattatgaaacggagggagtatt |
8626761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 10 - 52
Target Start/End: Original strand, 7761535 - 7761577
Alignment:
| Q |
10 |
attattcttcaaaatggacaagtattatgaaacggagggagta |
52 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
7761535 |
attattctctaaaatggacaagtattatgaaacggagggagta |
7761577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 10 - 52
Target Start/End: Original strand, 29260427 - 29260469
Alignment:
| Q |
10 |
attattcttcaaaatggacaagtattatgaaacggagggagta |
52 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
29260427 |
attattctctaaaatggacaagtattatgaaacggagggagta |
29260469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 20 - 52
Target Start/End: Original strand, 4129671 - 4129703
Alignment:
| Q |
20 |
aaaatggacaagtattatgaaacggagggagta |
52 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
4129671 |
aaaatggacaagtattatgaaacggagggagta |
4129703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 10 - 53
Target Start/End: Original strand, 13757442 - 13757485
Alignment:
| Q |
10 |
attattcttcaaaatggacaagtattatgaaacggagggagtat |
53 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| ||||||| |
|
|
| T |
13757442 |
attattctctaaaatggacaagtattatgaaacggatggagtat |
13757485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 14 - 52
Target Start/End: Complemental strand, 8626520 - 8626482
Alignment:
| Q |
14 |
ttcttcaaaatggacaagtattatgaaacggagggagta |
52 |
Q |
| |
|
|||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
8626520 |
ttcttcaaaatggacatgtattttgaaacggagggagta |
8626482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 10 - 52
Target Start/End: Complemental strand, 31559780 - 31559738
Alignment:
| Q |
10 |
attattcttcaaaatggacaagtattatgaaacggagggagta |
52 |
Q |
| |
|
|||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
31559780 |
attattctctaaaatggagaagtattatgaaacggagggagta |
31559738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 11)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 10 - 52
Target Start/End: Complemental strand, 18355910 - 18355868
Alignment:
| Q |
10 |
attattcttcaaaatggacaagtattatgaaacggagggagta |
52 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
18355910 |
attattcttcaaaatggacaagtattgtgaaacggagggagta |
18355868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 14 - 54
Target Start/End: Complemental strand, 37293475 - 37293435
Alignment:
| Q |
14 |
ttcttcaaaatggacaagtattatgaaacggagggagtatt |
54 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
37293475 |
ttcttcaaaatggacaagtattgtgaaacggagggagtatt |
37293435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 10 - 53
Target Start/End: Complemental strand, 19241710 - 19241667
Alignment:
| Q |
10 |
attattcttcaaaatggacaagtattatgaaacggagggagtat |
53 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
19241710 |
attattctctaaaatggacaagtattatgaaacggagggagtat |
19241667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 10 - 53
Target Start/End: Original strand, 29375367 - 29375410
Alignment:
| Q |
10 |
attattcttcaaaatggacaagtattatgaaacggagggagtat |
53 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
29375367 |
attattctctaaaatggacaagtattatgaaacggagggagtat |
29375410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 10 - 53
Target Start/End: Original strand, 36881515 - 36881558
Alignment:
| Q |
10 |
attattcttcaaaatggacaagtattatgaaacggagggagtat |
53 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
36881515 |
attattctctaaaatggacaagtattatgaaacggagggagtat |
36881558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 10 - 52
Target Start/End: Original strand, 13365078 - 13365120
Alignment:
| Q |
10 |
attattcttcaaaatggacaagtattatgaaacggagggagta |
52 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
13365078 |
attattctctaaaatggacaagtattatgaaacggagggagta |
13365120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 11 - 53
Target Start/End: Original strand, 13703448 - 13703490
Alignment:
| Q |
11 |
ttattcttcaaaatggacaagtattatgaaacggagggagtat |
53 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| ||||||| |
|
|
| T |
13703448 |
ttattcttcagaatggacaagtattatgaaacggatggagtat |
13703490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 10 - 52
Target Start/End: Complemental strand, 46694152 - 46694110
Alignment:
| Q |
10 |
attattcttcaaaatggacaagtattatgaaacggagggagta |
52 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
46694152 |
attattctctaaaatggacaagtattatgaaacggagggagta |
46694110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 10 - 54
Target Start/End: Original strand, 48820575 - 48820619
Alignment:
| Q |
10 |
attattcttcaaaatggacaagtattatgaaacggagggagtatt |
54 |
Q |
| |
|
|||||| || |||||||||||||||||||||||||||| |||||| |
|
|
| T |
48820575 |
attattttttaaaatggacaagtattatgaaacggaggaagtatt |
48820619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 10 - 53
Target Start/End: Complemental strand, 23087973 - 23087930
Alignment:
| Q |
10 |
attattcttcaaaatggacaagtattatgaaacggagggagtat |
53 |
Q |
| |
|
||||||||| ||||| |||||||||||||||||||||| ||||| |
|
|
| T |
23087973 |
attattctttaaaatcgacaagtattatgaaacggaggaagtat |
23087930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 22 - 52
Target Start/End: Complemental strand, 32835019 - 32834989
Alignment:
| Q |
22 |
aatggacaagtattatgaaacggagggagta |
52 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
32835019 |
aatggacaagtattatgaaacggagggagta |
32834989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 10)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 10 - 52
Target Start/End: Complemental strand, 12969782 - 12969740
Alignment:
| Q |
10 |
attattcttcaaaatggacaagtattatgaaacggagggagta |
52 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
12969782 |
attattctccaaaatggacaagtattatgaaacggagggagta |
12969740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 10 - 52
Target Start/End: Complemental strand, 40756953 - 40756911
Alignment:
| Q |
10 |
attattcttcaaaatggacaagtattatgaaacggagggagta |
52 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
40756953 |
attattctccaaaatggacaagtattatgaaacggagggagta |
40756911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 10 - 54
Target Start/End: Original strand, 23367024 - 23367068
Alignment:
| Q |
10 |
attattcttcaaaatggacaagtattatgaaacggagggagtatt |
54 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
23367024 |
attattctctaaaatggacaagtattatgaaacggagggagtatt |
23367068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 10 - 53
Target Start/End: Complemental strand, 22388180 - 22388137
Alignment:
| Q |
10 |
attattcttcaaaatggacaagtattatgaaacggagggagtat |
53 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
22388180 |
attattctctaaaatggacaagtattatgaaacggagggagtat |
22388137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 21 - 54
Target Start/End: Original strand, 1102747 - 1102780
Alignment:
| Q |
21 |
aaatggacaagtattatgaaacggagggagtatt |
54 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
1102747 |
aaatggacaagtattatgaaacggagggagtatt |
1102780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 10 - 54
Target Start/End: Original strand, 3519142 - 3519186
Alignment:
| Q |
10 |
attattcttcaaaatggacaagtattatgaaacggagggagtatt |
54 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| |||||| |
|
|
| T |
3519142 |
attattctctaaaatggacaagtattatgaaacggaggaagtatt |
3519186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 10 - 54
Target Start/End: Original strand, 39938405 - 39938449
Alignment:
| Q |
10 |
attattcttcaaaatggacaagtattatgaaacggagggagtatt |
54 |
Q |
| |
|
|||||||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
39938405 |
attattctctaaaatggacaagtattataaaacggagggagtatt |
39938449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 10 - 52
Target Start/End: Original strand, 1646522 - 1646564
Alignment:
| Q |
10 |
attattcttcaaaatggacaagtattatgaaacggagggagta |
52 |
Q |
| |
|
|||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
1646522 |
attattctctaaaatggacaggtattatgaaacggagggagta |
1646564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 11 - 52
Target Start/End: Complemental strand, 37673784 - 37673743
Alignment:
| Q |
11 |
ttattcttcaaaatggacaagtattatgaaacggagggagta |
52 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| |||||| |
|
|
| T |
37673784 |
ttattctctaaaatggacaagtattatgaaacggaaggagta |
37673743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 14 - 54
Target Start/End: Complemental strand, 3518946 - 3518906
Alignment:
| Q |
14 |
ttcttcaaaatggacaagtattatgaaacggagggagtatt |
54 |
Q |
| |
|
|||| ||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
3518946 |
ttctccaaaatggacatgtattttgaaacggagggagtatt |
3518906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 38; Significance: 0.000000000002; HSPs: 18)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 10 - 55
Target Start/End: Complemental strand, 11174265 - 11174220
Alignment:
| Q |
10 |
attattcttcaaaatggacaagtattatgaaacggagggagtattg |
55 |
Q |
| |
|
||||||||| |||||| ||||||||||||||||||||||||||||| |
|
|
| T |
11174265 |
attattctttaaaatgaacaagtattatgaaacggagggagtattg |
11174220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 10 - 55
Target Start/End: Complemental strand, 11646367 - 11646322
Alignment:
| Q |
10 |
attattcttcaaaatggacaagtattatgaaacggagggagtattg |
55 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
11646367 |
attattctctaaaatggacaagtattatgaaacggagggagtattg |
11646322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 10 - 54
Target Start/End: Complemental strand, 2539972 - 2539928
Alignment:
| Q |
10 |
attattcttcaaaatggacaagtattatgaaacggagggagtatt |
54 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |||||||| |
|
|
| T |
2539972 |
attattctttaaaatggacaagtattatgaaacggaaggagtatt |
2539928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 10 - 54
Target Start/End: Complemental strand, 30999566 - 30999522
Alignment:
| Q |
10 |
attattcttcaaaatggacaagtattatgaaacggagggagtatt |
54 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
30999566 |
attattctctaaaatggacaagtattatgaaacggagggagtatt |
30999522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 10 - 54
Target Start/End: Complemental strand, 43275441 - 43275397
Alignment:
| Q |
10 |
attattcttcaaaatggacaagtattatgaaacggagggagtatt |
54 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
43275441 |
attattctctaaaatggacaagtattatgaaacggagggagtatt |
43275397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 10 - 53
Target Start/End: Original strand, 36068315 - 36068358
Alignment:
| Q |
10 |
attattcttcaaaatggacaagtattatgaaacggagggagtat |
53 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
36068315 |
attattctctaaaatggacaagtattatgaaacggagggagtat |
36068358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 10 - 52
Target Start/End: Original strand, 7147148 - 7147190
Alignment:
| Q |
10 |
attattcttcaaaatggacaagtattatgaaacggagggagta |
52 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
7147148 |
attattctctaaaatggacaagtattatgaaacggagggagta |
7147190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 10 - 52
Target Start/End: Complemental strand, 40058345 - 40058303
Alignment:
| Q |
10 |
attattcttcaaaatggacaagtattatgaaacggagggagta |
52 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
40058345 |
attattctctaaaatggacaagtattatgaaacggagggagta |
40058303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 10 - 52
Target Start/End: Complemental strand, 40918773 - 40918731
Alignment:
| Q |
10 |
attattcttcaaaatggacaagtattatgaaacggagggagta |
52 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
40918773 |
attattctctaaaatggacaagtattatgaaacggagggagta |
40918731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 10 - 53
Target Start/End: Original strand, 27035230 - 27035273
Alignment:
| Q |
10 |
attattcttcaaaatggacaagtattatgaaacggagggagtat |
53 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||||||||| ||||| |
|
|
| T |
27035230 |
attattctccaaaatgaacaagtattatgaaacggaggcagtat |
27035273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 14 - 53
Target Start/End: Complemental strand, 28562459 - 28562420
Alignment:
| Q |
14 |
ttcttcaaaatggacaagtattatgaaacggagggagtat |
53 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
28562459 |
ttcttcaaaatggacaagtattttgaaacggaggaagtat |
28562420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 14 - 53
Target Start/End: Complemental strand, 28567957 - 28567918
Alignment:
| Q |
14 |
ttcttcaaaatggacaagtattatgaaacggagggagtat |
53 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
28567957 |
ttcttcaaaatggacaagtattttgaaacggaggaagtat |
28567918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 14 - 53
Target Start/End: Complemental strand, 28575550 - 28575511
Alignment:
| Q |
14 |
ttcttcaaaatggacaagtattatgaaacggagggagtat |
53 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
28575550 |
ttcttcaaaatggacaagtattttgaaacggaggaagtat |
28575511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 14 - 52
Target Start/End: Complemental strand, 37345609 - 37345571
Alignment:
| Q |
14 |
ttcttcaaaatggacaagtattatgaaacggagggagta |
52 |
Q |
| |
|
|||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
37345609 |
ttcttcaaaatggacatgtattttgaaacggagggagta |
37345571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 10 - 52
Target Start/End: Original strand, 37345806 - 37345848
Alignment:
| Q |
10 |
attattcttcaaaatggacaagtattatgaaacggagggagta |
52 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| |||||| |
|
|
| T |
37345806 |
attattctctaaaatggacaagtattatgaaacggaaggagta |
37345848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 14 - 52
Target Start/End: Original strand, 40486468 - 40486506
Alignment:
| Q |
14 |
ttcttcaaaatggacaagtattatgaaacggagggagta |
52 |
Q |
| |
|
|||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
40486468 |
ttcttcaaaatggacatgtattttgaaacggagggagta |
40486506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 13 - 54
Target Start/End: Original strand, 28562659 - 28562700
Alignment:
| Q |
13 |
attcttcaaaatggacaagtattatgaaacggagggagtatt |
54 |
Q |
| |
|
||||||||||||||| ||||||| ||| |||||||||||||| |
|
|
| T |
28562659 |
attcttcaaaatggataagtattgtgagacggagggagtatt |
28562700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 10 - 54
Target Start/End: Original strand, 3585686 - 3585730
Alignment:
| Q |
10 |
attattcttcaaaatggacaagtattatgaaacggagggagtatt |
54 |
Q |
| |
|
|||||||| ||||| |||||||||||||||||||| |||||||| |
|
|
| T |
3585686 |
attattctctaaaatagacaagtattatgaaacggatggagtatt |
3585730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 37; Significance: 0.000000000007; HSPs: 13)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 10 - 54
Target Start/End: Complemental strand, 20249056 - 20249012
Alignment:
| Q |
10 |
attattcttcaaaatggacaagtattatgaaacggagggagtatt |
54 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| ||||||| |
|
|
| T |
20249056 |
attattctccaaaatggacaagtattatgaaacggagtgagtatt |
20249012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 10 - 54
Target Start/End: Original strand, 25704886 - 25704930
Alignment:
| Q |
10 |
attattcttcaaaatggacaagtattatgaaacggagggagtatt |
54 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
25704886 |
attattctctaaaatggacaagtattatgaaacggagggagtatt |
25704930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 10 - 54
Target Start/End: Original strand, 44569072 - 44569116
Alignment:
| Q |
10 |
attattcttcaaaatggacaagtattatgaaacggagggagtatt |
54 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
44569072 |
attattctctaaaatggacaagtattatgaaacggagggagtatt |
44569116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 10 - 53
Target Start/End: Original strand, 14261279 - 14261322
Alignment:
| Q |
10 |
attattcttcaaaatggacaagtattatgaaacggagggagtat |
53 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
14261279 |
attattctctaaaatggacaagtattatgaaacggagggagtat |
14261322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 10 - 53
Target Start/End: Original strand, 21310656 - 21310699
Alignment:
| Q |
10 |
attattcttcaaaatggacaagtattatgaaacggagggagtat |
53 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
21310656 |
attattctctaaaatggacaagtattatgaaacggagggagtat |
21310699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 10 - 53
Target Start/End: Complemental strand, 24706289 - 24706246
Alignment:
| Q |
10 |
attattcttcaaaatggacaagtattatgaaacggagggagtat |
53 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
24706289 |
attattctctaaaatggacaagtattatgaaacggagggagtat |
24706246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 10 - 52
Target Start/End: Original strand, 12071795 - 12071837
Alignment:
| Q |
10 |
attattcttcaaaatggacaagtattatgaaacggagggagta |
52 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
12071795 |
attattctctaaaatggacaagtattatgaaacggagggagta |
12071837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 10 - 56
Target Start/End: Complemental strand, 22321310 - 22321264
Alignment:
| Q |
10 |
attattcttcaaaatggacaagtattatgaaacggagggagtattga |
56 |
Q |
| |
|
|||||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
22321310 |
attattctctaaaatagacaagtattatgaaacggagggagtattga |
22321264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 10 - 50
Target Start/End: Complemental strand, 21661577 - 21661537
Alignment:
| Q |
10 |
attattcttcaaaatggacaagtattatgaaacggagggag |
50 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
21661577 |
attattctctaaaatggacaagtattatgaaacggagggag |
21661537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 10 - 50
Target Start/End: Complemental strand, 21670341 - 21670301
Alignment:
| Q |
10 |
attattcttcaaaatggacaagtattatgaaacggagggag |
50 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
21670341 |
attattctctaaaatggacaagtattatgaaacggagggag |
21670301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 20 - 54
Target Start/End: Original strand, 39295421 - 39295455
Alignment:
| Q |
20 |
aaaatggacaagtattatgaaacggagggagtatt |
54 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| |
|
|
| T |
39295421 |
aaaatggacaagtattatgaaacggaaggagtatt |
39295455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 10 - 52
Target Start/End: Complemental strand, 40122529 - 40122487
Alignment:
| Q |
10 |
attattcttcaaaatggacaagtattatgaaacggagggagta |
52 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||| ||||| |
|
|
| T |
40122529 |
attattctctaaaatggacaagtattatgaaacggagagagta |
40122487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 10 - 51
Target Start/End: Original strand, 21064996 - 21065037
Alignment:
| Q |
10 |
attattcttcaaaatggacaagtattatgaaacggagggagt |
51 |
Q |
| |
|
|||||||| |||||| ||||||||||||||||||||||||| |
|
|
| T |
21064996 |
attattctctaaaatgaacaagtattatgaaacggagggagt |
21065037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 36; Significance: 0.00000000003; HSPs: 7)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 10 - 53
Target Start/End: Original strand, 27814046 - 27814089
Alignment:
| Q |
10 |
attattcttcaaaatggacaagtattatgaaacggagggagtat |
53 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
27814046 |
attattctctaaaatggacaagtattatgaaacggagggagtat |
27814089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 10 - 53
Target Start/End: Original strand, 40349196 - 40349239
Alignment:
| Q |
10 |
attattcttcaaaatggacaagtattatgaaacggagggagtat |
53 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
40349196 |
attattctctaaaatggacaagtattatgaaacggagggagtat |
40349239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 10 - 54
Target Start/End: Complemental strand, 36453166 - 36453122
Alignment:
| Q |
10 |
attattcttcaaaatggacaagtattatgaaacggagggagtatt |
54 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||| ||||||| |
|
|
| T |
36453166 |
attattctctaaaatggacaagtattatgaaacggagagagtatt |
36453122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 10 - 53
Target Start/End: Complemental strand, 25614395 - 25614352
Alignment:
| Q |
10 |
attattcttcaaaatggacaagtattatgaaacggagggagtat |
53 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
25614395 |
attattctctaaaatggacaattattatgaaacggagggagtat |
25614352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 10 - 57
Target Start/End: Original strand, 47110685 - 47110732
Alignment:
| Q |
10 |
attattcttcaaaatggacaagtattatgaaacggagggagtattgaa |
57 |
Q |
| |
|
|||||||| |||||| | ||||||||||||||||||||||||||||| |
|
|
| T |
47110685 |
attattctctaaaatgaataagtattatgaaacggagggagtattgaa |
47110732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 14 - 54
Target Start/End: Original strand, 25060148 - 25060188
Alignment:
| Q |
14 |
ttcttcaaaatggacaagtattatgaaacggagggagtatt |
54 |
Q |
| |
|
|||| ||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
25060148 |
ttctccaaaatggacatgtattttgaaacggagggagtatt |
25060188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 14 - 54
Target Start/End: Complemental strand, 27813849 - 27813809
Alignment:
| Q |
14 |
ttcttcaaaatggacaagtattatgaaacggagggagtatt |
54 |
Q |
| |
|
|||| ||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
27813849 |
ttctccaaaatggacatgtattttgaaacggagggagtatt |
27813809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0054 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: scaffold0054
Description:
Target: scaffold0054; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 10 - 52
Target Start/End: Original strand, 45688 - 45730
Alignment:
| Q |
10 |
attattcttcaaaatggacaagtattatgaaacggagggagta |
52 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
45688 |
attattctctaaaatggacaagtattatgaaacggagggagta |
45730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1770 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold1770
Description:
Target: scaffold1770; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 20 - 52
Target Start/End: Original strand, 406 - 438
Alignment:
| Q |
20 |
aaaatggacaagtattatgaaacggagggagta |
52 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
406 |
aaaatggacaagtattatgaaacggagggagta |
438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University