View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1137_high_125 (Length: 267)
Name: NF1137_high_125
Description: NF1137
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1137_high_125 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 30 - 257
Target Start/End: Original strand, 43107684 - 43107911
Alignment:
| Q |
30 |
gtaaagccttattggattggaagttctttttgcaaacatcacaacttaattttacatcattagaattgcaattagcctttgctttcgactcaccctcttt |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
43107684 |
gtaaagccttattggattggaagttctttttgcaaacatcacaacttaattttacatcattagaattgcaattagcctctgctttcgactcaccctcttt |
43107783 |
T |
 |
| Q |
130 |
ccctagggcttgactatggattcttttgtgaccacctaatccttttccacacctaaaaattttgttacataattcacacttgtgaatttttgaacttgtt |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43107784 |
ccctagggcttgactatggattcttttgtgaccacctaatccttttccacacctaaaaattttgttacataattcacacttgtgaatttttgaacttgtt |
43107883 |
T |
 |
| Q |
230 |
gatccttcatcatgatgatgaccctttg |
257 |
Q |
| |
|
|||||||||||||||||| ||||||||| |
|
|
| T |
43107884 |
gatccttcatcatgatgacgaccctttg |
43107911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University