View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1137_high_126 (Length: 266)
Name: NF1137_high_126
Description: NF1137
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1137_high_126 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 88; Significance: 2e-42; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 133 - 266
Target Start/End: Original strand, 45414970 - 45415102
Alignment:
| Q |
133 |
gagtctatgactaatagcaatccgacctaagtattaaattgtttgatcaaattaagtttgatttttataaagtttaacttagtctagtctattcacaccc |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||| ||| ||||| |||||||||||||||| |
|
|
| T |
45414970 |
gagtctatgactaatagcaatccgacctaagtattaaattgtttgaccaaattaagtttgagttttataaagtctaatttagtttagtctattcacaccc |
45415069 |
T |
 |
| Q |
233 |
ctannnnnnncatcaattaatcatataacaaaaa |
266 |
Q |
| |
|
||| |||||||||||||||||||||||| |
|
|
| T |
45415070 |
cta-ttttttcatcaattaatcatataacaaaaa |
45415102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University