View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1137_high_141 (Length: 248)
Name: NF1137_high_141
Description: NF1137
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1137_high_141 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 94; Significance: 5e-46; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 76 - 244
Target Start/End: Original strand, 38024255 - 38024429
Alignment:
| Q |
76 |
ggtacaaaggtgactgaatgttttattaggctaataaatgtaaaataattgannnnnnnnnnnn-------gtagtggccggggtttgaatccggacctt |
168 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||| |
|
|
| T |
38024255 |
ggtacaaaggtgactgaatgttttattaggctaataaatgtaaaataattgattttttttaatttttttttgtggtggccggggtttgaatccggacctt |
38024354 |
T |
 |
| Q |
169 |
gcatataacctattattagtacagttctaatcacattcgtgacaattgtcagaataaattcattacctaaacatct |
244 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||| |
|
|
| T |
38024355 |
gcatataacctattat-agtacagttctaatcacattcgtgacaatggtcagaataaattcatgacctaaacatct |
38024429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 167 - 248
Target Start/End: Original strand, 38026030 - 38026111
Alignment:
| Q |
167 |
ttgcatataacctattattagtacagttctaatcacattcgtgacaattgtcagaataaattcattacctaaacatctgaaa |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| ||||||| |||||||||||||||| ||| || ||||||||| |
|
|
| T |
38026030 |
ttgcatataacctattattagtacagttctagtcacattcttgacaatggtcagaataaattcatgaccaaatcatctgaaa |
38026111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000005; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 140 - 175
Target Start/End: Original strand, 3648894 - 3648929
Alignment:
| Q |
140 |
gtagtggccggggtttgaatccggaccttgcatata |
175 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |
|
|
| T |
3648894 |
gtagtggccgggatttgaatccggaccttgcatata |
3648929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 140 - 175
Target Start/End: Complemental strand, 56205017 - 56204982
Alignment:
| Q |
140 |
gtagtggccggggtttgaatccggaccttgcatata |
175 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
56205017 |
gtagtggccgaggtttgaatccggaccttgcatata |
56204982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University