View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1137_high_146 (Length: 242)
Name: NF1137_high_146
Description: NF1137
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1137_high_146 |
 |  |
|
| [»] scaffold0110 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr3 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 11 - 126
Target Start/End: Original strand, 24226724 - 24226839
Alignment:
| Q |
11 |
tccaagaatatggttcctgacactgtagcatacaattccctaattgatggactttgcaaatcagggagaatatatgatgtttgggatttcataggtgaga |
110 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
24226724 |
tccaaaaatatggttcctgacactgtagcatacaattccctaattgatggactttgcaaatcaaggagaatatatgatgtttgggatttcataggtgaga |
24226823 |
T |
 |
| Q |
111 |
tgcatgatagaggtca |
126 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
24226824 |
tgcatgatagaggtca |
24226839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0110 (Bit Score: 76; Significance: 3e-35; HSPs: 1)
Name: scaffold0110
Description:
Target: scaffold0110; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 11 - 126
Target Start/End: Complemental strand, 43964 - 43849
Alignment:
| Q |
11 |
tccaagaatatggttcctgacactgtagcatacaattccctaattgatggactttgcaaatcagggagaatatatgatgtttgggatttcataggtgaga |
110 |
Q |
| |
|
||||| |||||||||||| |||||||| ||||||||||| ||||||||||||||||||||| ||||||||| | ||||| ||||||||| |||| ||||| |
|
|
| T |
43964 |
tccaaaaatatggttcctaacactgtaacatacaattccttaattgatggactttgcaaattagggagaatgtctgatgcttgggattttatagatgaga |
43865 |
T |
 |
| Q |
111 |
tgcatgatagaggtca |
126 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
43864 |
tgcatgatagaggtca |
43849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 73; Significance: 2e-33; HSPs: 8)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 18 - 126
Target Start/End: Original strand, 30149438 - 30149546
Alignment:
| Q |
18 |
atatggttcctgacactgtagcatacaattccctaattgatggactttgcaaatcagggagaatatatgatgtttgggatttcataggtgagatgcatga |
117 |
Q |
| |
|
||||| ||||| |||||||| ||||||||||||| ||||||||||||||||||| ||||||| ||| ||||||||||||||| |||| |||||||||||| |
|
|
| T |
30149438 |
atatgattcctaacactgtaacatacaattcccttattgatggactttgcaaattagggagagtatctgatgtttgggattttatagatgagatgcatga |
30149537 |
T |
 |
| Q |
118 |
tagaggtca |
126 |
Q |
| |
|
||||||||| |
|
|
| T |
30149538 |
tagaggtca |
30149546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 126
Target Start/End: Original strand, 24897990 - 24898096
Alignment:
| Q |
20 |
atggttcctgacactgtagcatacaattccctaattgatggactttgcaaatcagggagaatatatgatgtttgggatttcataggtgagatgcatgata |
119 |
Q |
| |
|
|||| |||||| | ||||||||||| ||| || |||||||||||||||||||| |||| ||||| ||||||||||||| | |||| ||| |||||||||| |
|
|
| T |
24897990 |
atggctcctgatattgtagcatacagttcacttattgatggactttgcaaatcggggaaaatatctgatgtttgggatcttatagatgatatgcatgata |
24898089 |
T |
 |
| Q |
120 |
gaggtca |
126 |
Q |
| |
|
||||||| |
|
|
| T |
24898090 |
gaggtca |
24898096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 39 - 126
Target Start/End: Complemental strand, 29953761 - 29953674
Alignment:
| Q |
39 |
catacaattccctaattgatggactttgcaaatcagggagaatatatgatgtttgggatttcataggtgagatgcatgatagaggtca |
126 |
Q |
| |
|
|||||||||| || |||||||||||||||||||||||||| || | ||||||||||||| | |||| |||||||||| ||||| |||| |
|
|
| T |
29953761 |
catacaattctcttattgatggactttgcaaatcagggagcatctctgatgtttgggatcttatagatgagatgcataatagatgtca |
29953674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 32 - 97
Target Start/End: Complemental strand, 29949971 - 29949906
Alignment:
| Q |
32 |
actgtagcatacaattccctaattgatggactttgcaaatcagggagaatatatgatgtttgggat |
97 |
Q |
| |
|
|||||| |||||||||| || ||||||||||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
29949971 |
actgtatcatacaattctcttattgatggactttgcaaatcagggagaatctctgatgtttgggat |
29949906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 40 - 123
Target Start/End: Original strand, 24942133 - 24942216
Alignment:
| Q |
40 |
atacaattccctaattgatggactttgcaaatcagggagaatatatgatgtttgggatttcataggtgagatgcatgatagagg |
123 |
Q |
| |
|
||||| ||| || |||||||||||||||||||| || ||||| | ||||||||||||| | |||| |||||||||| ||||||| |
|
|
| T |
24942133 |
atacagttcgcttattgatggactttgcaaatcgggaagaatctctgatgtttgggatcttatagatgagatgcataatagagg |
24942216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 53 - 126
Target Start/End: Original strand, 30135071 - 30135144
Alignment:
| Q |
53 |
attgatggactttgcaaatcagggagaatatatgatgtttgggatttcataggtgagatgcatgatagaggtca |
126 |
Q |
| |
|
|||||||||||||||| ||| ||||||| | ||||||||||||| | |||| |||||||||||| |||||||| |
|
|
| T |
30135071 |
attgatggactttgcatatcggggagaacctctgatgtttgggatcttatagatgagatgcatgaaagaggtca |
30135144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 39 - 114
Target Start/End: Original strand, 30154432 - 30154507
Alignment:
| Q |
39 |
catacaattccctaattgatggactttgcaaatcagggagaatatatgatgtttgggatttcataggtgagatgca |
114 |
Q |
| |
|
||||||||||||| ||||| || ||||||||||| |||||||| | |||||||||| || | |||| ||||||||| |
|
|
| T |
30154432 |
catacaattcccttattgacgggctttgcaaatcggggagaatctctgatgtttggtatcttatagatgagatgca |
30154507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 39 - 97
Target Start/End: Original strand, 30053359 - 30053417
Alignment:
| Q |
39 |
catacaattccctaattgatggactttgcaaatcagggagaatatatgatgtttgggat |
97 |
Q |
| |
|
|||||| ||| || |||||||||||||||||||| || ||||| | ||||||||||||| |
|
|
| T |
30053359 |
catacagttcacttattgatggactttgcaaatcgggaagaatctctgatgtttgggat |
30053417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 49; Significance: 4e-19; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 39 - 115
Target Start/End: Complemental strand, 44262660 - 44262584
Alignment:
| Q |
39 |
catacaattccctaattgatggactttgcaaatcagggagaatatatgatgtttgggatttcataggtgagatgcat |
115 |
Q |
| |
|
|||||||||| || ||||||||||||||||||||||| ||||||| ||||||||||||| | |||| |||||||||| |
|
|
| T |
44262660 |
catacaattcacttattgatggactttgcaaatcaggaagaatatctgatgtttgggatcttatagatgagatgcat |
44262584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 34 - 122
Target Start/End: Complemental strand, 13093605 - 13093518
Alignment:
| Q |
34 |
tgtagcatacaattccctaattgatggactttgcaaatcagggagaatatatgatgtttgggatttcataggtgagatgcatgatagag |
122 |
Q |
| |
|
|||| |||||||||| || |||||||||||||||||||||| |||| | ||||||||||| ||| | || | ||||||||| ||||||| |
|
|
| T |
13093605 |
tgtaacatacaattcacttattgatggactttgcaaatcagagagattctatgatgtttgtgatct-atggatgagatgcacgatagag |
13093518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University