View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1137_high_148 (Length: 235)

Name: NF1137_high_148
Description: NF1137
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1137_high_148
NF1137_high_148
[»] chr3 (1 HSPs)
chr3 (11-126)||(24226724-24226839)
[»] scaffold0110 (1 HSPs)
scaffold0110 (11-126)||(43849-43964)
[»] chr6 (8 HSPs)
chr6 (18-126)||(30149438-30149546)
chr6 (20-126)||(24897990-24898096)
chr6 (39-126)||(29953674-29953761)
chr6 (32-97)||(29949906-29949971)
chr6 (40-123)||(24942133-24942216)
chr6 (53-126)||(30135071-30135144)
chr6 (39-114)||(30154432-30154507)
chr6 (39-97)||(30053359-30053417)
[»] chr4 (1 HSPs)
chr4 (39-115)||(44262584-44262660)
[»] chr7 (1 HSPs)
chr7 (34-122)||(13093518-13093605)


Alignment Details
Target: chr3 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 11 - 126
Target Start/End: Original strand, 24226724 - 24226839
Alignment:
11 tccaagaatatggttcctgacactgtagcatacaattccctaattgatggactttgcaaatcagggagaatatatgatgtttgggatttcataggtgaga 110  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
24226724 tccaaaaatatggttcctgacactgtagcatacaattccctaattgatggactttgcaaatcaaggagaatatatgatgtttgggatttcataggtgaga 24226823  T
111 tgcatgatagaggtca 126  Q
    ||||||||||||||||    
24226824 tgcatgatagaggtca 24226839  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0110 (Bit Score: 76; Significance: 3e-35; HSPs: 1)
Name: scaffold0110
Description:

Target: scaffold0110; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 11 - 126
Target Start/End: Complemental strand, 43964 - 43849
Alignment:
11 tccaagaatatggttcctgacactgtagcatacaattccctaattgatggactttgcaaatcagggagaatatatgatgtttgggatttcataggtgaga 110  Q
    ||||| |||||||||||| |||||||| ||||||||||| ||||||||||||||||||||| ||||||||| | ||||| ||||||||| |||| |||||    
43964 tccaaaaatatggttcctaacactgtaacatacaattccttaattgatggactttgcaaattagggagaatgtctgatgcttgggattttatagatgaga 43865  T
111 tgcatgatagaggtca 126  Q
    ||||||||||||||||    
43864 tgcatgatagaggtca 43849  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 73; Significance: 2e-33; HSPs: 8)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 18 - 126
Target Start/End: Original strand, 30149438 - 30149546
Alignment:
18 atatggttcctgacactgtagcatacaattccctaattgatggactttgcaaatcagggagaatatatgatgtttgggatttcataggtgagatgcatga 117  Q
    ||||| ||||| |||||||| ||||||||||||| ||||||||||||||||||| ||||||| ||| ||||||||||||||| |||| ||||||||||||    
30149438 atatgattcctaacactgtaacatacaattcccttattgatggactttgcaaattagggagagtatctgatgtttgggattttatagatgagatgcatga 30149537  T
118 tagaggtca 126  Q
    |||||||||    
30149538 tagaggtca 30149546  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 126
Target Start/End: Original strand, 24897990 - 24898096
Alignment:
20 atggttcctgacactgtagcatacaattccctaattgatggactttgcaaatcagggagaatatatgatgtttgggatttcataggtgagatgcatgata 119  Q
    |||| |||||| | ||||||||||| ||| || |||||||||||||||||||| |||| ||||| ||||||||||||| | |||| ||| ||||||||||    
24897990 atggctcctgatattgtagcatacagttcacttattgatggactttgcaaatcggggaaaatatctgatgtttgggatcttatagatgatatgcatgata 24898089  T
120 gaggtca 126  Q
    |||||||    
24898090 gaggtca 24898096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 39 - 126
Target Start/End: Complemental strand, 29953761 - 29953674
Alignment:
39 catacaattccctaattgatggactttgcaaatcagggagaatatatgatgtttgggatttcataggtgagatgcatgatagaggtca 126  Q
    |||||||||| || |||||||||||||||||||||||||| || | ||||||||||||| | |||| |||||||||| ||||| ||||    
29953761 catacaattctcttattgatggactttgcaaatcagggagcatctctgatgtttgggatcttatagatgagatgcataatagatgtca 29953674  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 32 - 97
Target Start/End: Complemental strand, 29949971 - 29949906
Alignment:
32 actgtagcatacaattccctaattgatggactttgcaaatcagggagaatatatgatgtttgggat 97  Q
    |||||| |||||||||| || ||||||||||||||||||||||||||||| | |||||||||||||    
29949971 actgtatcatacaattctcttattgatggactttgcaaatcagggagaatctctgatgtttgggat 29949906  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 40 - 123
Target Start/End: Original strand, 24942133 - 24942216
Alignment:
40 atacaattccctaattgatggactttgcaaatcagggagaatatatgatgtttgggatttcataggtgagatgcatgatagagg 123  Q
    ||||| ||| || |||||||||||||||||||| || ||||| | ||||||||||||| | |||| |||||||||| |||||||    
24942133 atacagttcgcttattgatggactttgcaaatcgggaagaatctctgatgtttgggatcttatagatgagatgcataatagagg 24942216  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 53 - 126
Target Start/End: Original strand, 30135071 - 30135144
Alignment:
53 attgatggactttgcaaatcagggagaatatatgatgtttgggatttcataggtgagatgcatgatagaggtca 126  Q
    |||||||||||||||| ||| |||||||  | ||||||||||||| | |||| |||||||||||| ||||||||    
30135071 attgatggactttgcatatcggggagaacctctgatgtttgggatcttatagatgagatgcatgaaagaggtca 30135144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 39 - 114
Target Start/End: Original strand, 30154432 - 30154507
Alignment:
39 catacaattccctaattgatggactttgcaaatcagggagaatatatgatgtttgggatttcataggtgagatgca 114  Q
    ||||||||||||| ||||| || ||||||||||| |||||||| | |||||||||| || | |||| |||||||||    
30154432 catacaattcccttattgacgggctttgcaaatcggggagaatctctgatgtttggtatcttatagatgagatgca 30154507  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 39 - 97
Target Start/End: Original strand, 30053359 - 30053417
Alignment:
39 catacaattccctaattgatggactttgcaaatcagggagaatatatgatgtttgggat 97  Q
    |||||| ||| || |||||||||||||||||||| || ||||| | |||||||||||||    
30053359 catacagttcacttattgatggactttgcaaatcgggaagaatctctgatgtttgggat 30053417  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 49; Significance: 4e-19; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 39 - 115
Target Start/End: Complemental strand, 44262660 - 44262584
Alignment:
39 catacaattccctaattgatggactttgcaaatcagggagaatatatgatgtttgggatttcataggtgagatgcat 115  Q
    |||||||||| || ||||||||||||||||||||||| ||||||| ||||||||||||| | |||| ||||||||||    
44262660 catacaattcacttattgatggactttgcaaatcaggaagaatatctgatgtttgggatcttatagatgagatgcat 44262584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 34 - 122
Target Start/End: Complemental strand, 13093605 - 13093518
Alignment:
34 tgtagcatacaattccctaattgatggactttgcaaatcagggagaatatatgatgtttgggatttcataggtgagatgcatgatagag 122  Q
    |||| |||||||||| || |||||||||||||||||||||| |||| | ||||||||||| ||| | || | ||||||||| |||||||    
13093605 tgtaacatacaattcacttattgatggactttgcaaatcagagagattctatgatgtttgtgatct-atggatgagatgcacgatagag 13093518  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University