View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1137_high_158 (Length: 204)
Name: NF1137_high_158
Description: NF1137
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1137_high_158 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 130; Significance: 1e-67; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 130; E-Value: 1e-67
Query Start/End: Original strand, 26 - 191
Target Start/End: Original strand, 15887606 - 15887771
Alignment:
| Q |
26 |
cccaaatattatggtgattagatcaaacttgattgccttgtgaaaattgcacaagaggctcatgattttgatgtaccggtaaaacatttattnnnnnnnn |
125 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||| ||||||| |
|
|
| T |
15887606 |
cccaaatattatggtgattagatcaaacttgattgccttttgaaaattgcacaagaggctcatgattttgatgtaccggcaaaatatttattaaaaaaaa |
15887705 |
T |
 |
| Q |
126 |
tatgaataattttgatgtaccggtttcatagttttttcatcattcacctgaagtttaatgcaacag |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15887706 |
tatgaataattttgatgtaccggtttcatagttttttcatcattcacctgaagtttaatgcaacag |
15887771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University