View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1137_high_29 (Length: 550)
Name: NF1137_high_29
Description: NF1137
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1137_high_29 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 129; Significance: 2e-66; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 129; E-Value: 2e-66
Query Start/End: Original strand, 16 - 156
Target Start/End: Complemental strand, 14960985 - 14960845
Alignment:
| Q |
16 |
atcataaacgaaagacgtggtaaagaaaactgaatgctttcctcttcaaaaagaaaggatttttgaggtttcactgacctgtataatgtattggtcttac |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14960985 |
atcataaacgaaagacgtggtaaagaaaactgaatgctttcctcttcaaaaagaaaggatttttgaggtttcactgacctgtataatgtattggtcttac |
14960886 |
T |
|
| Q |
116 |
tgaaaaatgaccaagatcagcaaacattgcctcagaacctg |
156 |
Q |
| |
|
||||||||||||||||||| |||||||||| || ||||||| |
|
|
| T |
14960885 |
tgaaaaatgaccaagatcaccaaacattgcttctgaacctg |
14960845 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University