View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1137_high_72 (Length: 368)
Name: NF1137_high_72
Description: NF1137
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1137_high_72 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 318; Significance: 1e-179; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 318; E-Value: 1e-179
Query Start/End: Original strand, 30 - 355
Target Start/End: Complemental strand, 38053198 - 38052873
Alignment:
| Q |
30 |
agagtaaccttggggtcgtgaatgaagctgtgaccagacctagcattaggaggtaactcaccggtgcaagaaagcttcaagcattcaatgatcgtctgcg |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38053198 |
agagtaaccttggggtcgtgaatgaagctgtgaccagacctagcattaggaggtaactcaccggtgcaagaaagcttcaagcattcaatgatcgtctgcg |
38053099 |
T |
 |
| Q |
130 |
aaaaaatgcatgtttgagaatcaattaaattgattggatgagggtgattatttagaaatgaaatggaacatacggttttgccggcaccgttgggaccgac |
229 |
Q |
| |
|
||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38053098 |
aaaaaatgcatgtgtgagaatcgattaaattgattggatgagggtgattatttagaaatgaaatggaacatacggttttgccggcaccgttgggaccgac |
38052999 |
T |
 |
| Q |
230 |
gattagggttaagggtttgaagaaggtgatgacgttcttgttttccgggtcgaaacttcggatgcctttgatcagcatcttgtcgaccgtactcattttt |
329 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38052998 |
gattagggttaagggtttgaagaaggtgatgacgttcttgttttccgggtcgaaacttcggatgcctttgatcagcatcttgtcgaccgtactcattttt |
38052899 |
T |
 |
| Q |
330 |
gcttccctccttttcttcgcttcttc |
355 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
38052898 |
gcttccctccttttcttcgcttcttc |
38052873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University