View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1137_high_96 (Length: 322)
Name: NF1137_high_96
Description: NF1137
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1137_high_96 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 24 - 224
Target Start/End: Complemental strand, 40776457 - 40776256
Alignment:
| Q |
24 |
tctgagtttgggtagttattgttcggtgttttggttttgttgatttgttctttattagttaaatgaatcaatgaaagtgattaattagtataacttttaa |
123 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
40776457 |
tctgagtttcggtagttattgttcggtgttttggttttgttgatttgttctttattagttaaatgaatcaatgaaagtgattaattagtataacttttga |
40776358 |
T |
|
| Q |
124 |
gattgaacagtaaaataatgcag-agttgatttggaagaaagataaaaattcatttccaaagagtgaaattatttaggccctgattagataaacatcttc |
222 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
40776357 |
gattgaacagtaaaataatgcagcagttgatttggaagaaagataaaaattcatttccaaagagtgaaatcatttaggccctgattagataaacatcttc |
40776258 |
T |
|
| Q |
223 |
at |
224 |
Q |
| |
|
|| |
|
|
| T |
40776257 |
at |
40776256 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University