View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1137_low_107 (Length: 341)
Name: NF1137_low_107
Description: NF1137
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1137_low_107 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 337; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 337; E-Value: 0
Query Start/End: Original strand, 1 - 341
Target Start/End: Complemental strand, 22360860 - 22360520
Alignment:
| Q |
1 |
acttcgtcctcatcttcatcatcatcctgctctataactagttctggaagcgcatgatcatgaaccgatgattttggctcaggctcttgacaaactccag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22360860 |
acttcgtcctcatcttcatcatcatcctgctctataactagttctggaagcgcatgatcatgaaccgatgattttggctcaggctcttgacaaactccag |
22360761 |
T |
 |
| Q |
101 |
agacggcagaaaatgggggactgagttcccaatcatatgtggatgatactttgatgctttgatatgaattggattcaatactgattgtttccggggatgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
22360760 |
agacggcagaaaatgggggactgagttcccaatcatatgtggatgatactttgatgctttgatatgaattggattcaacactgattgtttccggggatgt |
22360661 |
T |
 |
| Q |
201 |
gactcttcttgagtacccattatcctggaaatcaaaagattgatttccaggataatgtctcttttgtttaattgggtgctcctcatacatcacactagat |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22360660 |
gactcttcttgagtacccattatcctggaaatcaaaagattgatttccaggataatgtctcttttgtttaattgggtgctcctcatacatcacactagat |
22360561 |
T |
 |
| Q |
301 |
gagttccatttatatggaactttgattggcctgtaatgtaa |
341 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22360560 |
gagttccatttatatggaactttgattggcctgtaatgtaa |
22360520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 49; Significance: 5e-19; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 257 - 333
Target Start/End: Original strand, 54306861 - 54306937
Alignment:
| Q |
257 |
gtctcttttgtttaattgggtgctcctcatacatcacactagatgagttccatttatatggaactttgattggcctg |
333 |
Q |
| |
|
|||||||||||||||||||||||||||||| || |||| | ||||||||||||||| |||| |||| |||||||||| |
|
|
| T |
54306861 |
gtctcttttgtttaattgggtgctcctcatgcaacacaatggatgagttccatttacatgggacttcgattggcctg |
54306937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 10 - 131
Target Start/End: Original strand, 54306617 - 54306738
Alignment:
| Q |
10 |
tcatcttcatcatcatcctgctctataactagttctggaagcgcatgatcatgaaccgatgattttggctcaggctcttgacaaactccagagacggcag |
109 |
Q |
| |
|
||||| ||||| ||||| |||||||||||||||| |||||| |||||| ||||| | |||||||| ||| ||||||||| ||||||||| || | || |
|
|
| T |
54306617 |
tcatcatcatcgtcatcttgctctataactagtttgggaagcacatgattgtgaacataagattttggatcaagctcttgactaactccagaaacagaag |
54306716 |
T |
 |
| Q |
110 |
aaaatgggggactgagttccca |
131 |
Q |
| |
|
|| |||||||||||| |||||| |
|
|
| T |
54306717 |
aacatgggggactgaattccca |
54306738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 162 - 227
Target Start/End: Original strand, 54306738 - 54306805
Alignment:
| Q |
162 |
atatgaattggattcaatactgattgtttccgggg--atgtgactcttcttgagtacccattatcctg |
227 |
Q |
| |
|
||||||||||||||||| ||| |||||||| |||| |||||||||||||||||||| ||| |||||| |
|
|
| T |
54306738 |
atatgaattggattcaacactaattgtttctggggggatgtgactcttcttgagtactcataatcctg |
54306805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University