View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1137_low_112 (Length: 336)
Name: NF1137_low_112
Description: NF1137
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1137_low_112 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 89 - 319
Target Start/End: Original strand, 32701675 - 32701905
Alignment:
| Q |
89 |
acaaacatggcaaggttttcgagatttcaaaacaggcacacattgtgttcggttcctcggataaacctttaatgtcggggcagtgaccgcactctgccta |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32701675 |
acaaacatggcaaggttttcgagatttcaaaacaggcacacattgtgtttggttcctcggataaacctttaatgtcggggcagtgaccgcactctgccta |
32701774 |
T |
 |
| Q |
189 |
acacattctaagccagatgatggttttgctcttgggattatgaagctgctagagagagggttggcattcattgacaatccaagcggcgtggctgatattt |
288 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32701775 |
acacattctaagccagatgatggttttgctcttgggattatgaagctgctagagagagggttggcattcattgacaatccaagcggcgtggctgatattt |
32701874 |
T |
 |
| Q |
289 |
tattgtgacataaattgcaggattggttgca |
319 |
Q |
| |
|
| ||||||||||||||||||||||||||||| |
|
|
| T |
32701875 |
ttttgtgacataaattgcaggattggttgca |
32701905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 100; Significance: 2e-49; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 89 - 268
Target Start/End: Original strand, 3957600 - 3957779
Alignment:
| Q |
89 |
acaaacatggcaaggttttcgagatttcaaaacaggcacacattgtgttcggttcctcggataaacctttaatgtcggggcagtgaccgcactctgccta |
188 |
Q |
| |
|
||||||||| | ||||||| |||||||||||||||||||| |||||||| |||| || ||||||||||||||| ||||||||| ||| ||||||||| |
|
|
| T |
3957600 |
acaaacatgtcgaggtttttgagatttcaaaacaggcacagattgtgttaggttacttggataaacctttaatactggggcagtggtcgcgctctgccta |
3957699 |
T |
 |
| Q |
189 |
acacattctaagccagatgatggttttgctcttgggattatgaagctgctagagagagggttggcattcattgacaatcc |
268 |
Q |
| |
|
||||| | |||||||||||| |||||||||||||||||| |||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
3957700 |
acacaatataagccagatgaaagttttgctcttgggattaggaaggtcctagagagagggttggcattcattgacaatcc |
3957779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University