View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1137_low_128 (Length: 319)
Name: NF1137_low_128
Description: NF1137
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1137_low_128 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 134; Significance: 1e-69; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 134; E-Value: 1e-69
Query Start/End: Original strand, 102 - 235
Target Start/End: Complemental strand, 25885820 - 25885687
Alignment:
| Q |
102 |
atttagagcagaaaaaatgtcagaaaattttataaacaattggccaaaaccagaggaaaatagtaagcatccagttatagtagccttatttaggtgtttt |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25885820 |
atttagagcagaaaaaatgtcagaaaattttataaacaattggccaaaaccagaggaaaatagtaagcatccagttatagtagccttatttaggtgtttt |
25885721 |
T |
|
| Q |
202 |
tggaaacacatagctttcactggcttccttgcaa |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
25885720 |
tggaaacacatagctttcactggcttccttgcaa |
25885687 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 121; E-Value: 5e-62
Query Start/End: Original strand, 102 - 234
Target Start/End: Complemental strand, 44349664 - 44349532
Alignment:
| Q |
102 |
atttagagcagaaaaaatgtcagaaaattttataaacaattggccaaaaccagaggaaaatagtaagcatccagttatagtagccttatttaggtgtttt |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
44349664 |
atttagagcagaaaaaatgtcagaaaattttataaacaattggccaaaaccagaggaaaacagtaagcatccagttatggtagccttatttaggtgtttt |
44349565 |
T |
|
| Q |
202 |
tggaaacacatagctttcactggcttccttgca |
234 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
44349564 |
tggaaacacatagctatcactggcttccttgca |
44349532 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 85; Significance: 2e-40; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 103 - 235
Target Start/End: Complemental strand, 14282988 - 14282856
Alignment:
| Q |
103 |
tttagagcagaaaaaatgtcagaaaattttataaacaattggccaaaaccagaggaaaatagtaagcatccagttatagtagccttatttaggtgttttt |
202 |
Q |
| |
|
|||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||| ||| || | ||||||||||||| |
|
|
| T |
14282988 |
tttagagcagaaaaaatgtcagaactttttcaaaacaattggccaaaaccagaggaaaatagtaagcatccagttggagttaccctttttaggtgttttt |
14282889 |
T |
|
| Q |
203 |
ggaaacacatagctttcactggcttccttgcaa |
235 |
Q |
| |
|
|||||||||||||||| || ||||||||||||| |
|
|
| T |
14282888 |
ggaaacacatagcttttacgggcttccttgcaa |
14282856 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 72; E-Value: 9e-33
Query Start/End: Original strand, 103 - 234
Target Start/End: Complemental strand, 14304746 - 14304615
Alignment:
| Q |
103 |
tttagagcagaaaaaatgtcagaaaattttataaacaattggccaaaaccagaggaaaatagtaagcatccagttatagtagccttatttaggtgttttt |
202 |
Q |
| |
|
|||||||||||||||||||| ||| |||| |||||||||||| |||||||||||||| ||||||||||||||| ||| || | ||||||||||||| |
|
|
| T |
14304746 |
tttagagcagaaaaaatgtctgaactttttcaaaacaattggccgaaaccagaggaaaacagtaagcatccagttggagttaccctttttaggtgttttt |
14304647 |
T |
|
| Q |
203 |
ggaaacacatagctttcactggcttccttgca |
234 |
Q |
| |
|
|||||||||||| |||||||||||| |||||| |
|
|
| T |
14304646 |
ggaaacacatagttttcactggctttcttgca |
14304615 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 103 - 234
Target Start/End: Complemental strand, 14321137 - 14321006
Alignment:
| Q |
103 |
tttagagcagaaaaaatgtcagaaaattttataaacaattggccaaaaccagaggaaaatagtaagcatccagttatagtagccttatttaggtgttttt |
202 |
Q |
| |
|
|||||||||||||||||||| ||| |||| || |||||||||||||||||||||||| ||||||||||||||| ||| || | ||||||||||||| |
|
|
| T |
14321137 |
tttagagcagaaaaaatgtctgaactttttcaaagcaattggccaaaaccagaggaaaacagtaagcatccagttggagttaccctttttaggtgttttt |
14321038 |
T |
|
| Q |
203 |
ggaaacacatagctttcactggcttccttgca |
234 |
Q |
| |
|
||||||| ||||||||||| |||||| ||||| |
|
|
| T |
14321037 |
ggaaacaaatagctttcacgggcttcattgca |
14321006 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University