View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1137_low_129 (Length: 319)
Name: NF1137_low_129
Description: NF1137
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1137_low_129 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 118; Significance: 3e-60; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 116 - 241
Target Start/End: Original strand, 2057706 - 2057831
Alignment:
| Q |
116 |
ttaaactcaagtgttaaacttttaattaaattcataaaaattccaacacttagactgaactctacaattttaaagtttaacacatgaatttaattaaatt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
2057706 |
ttaaactcaagtgttaaacttttaattaaattcataaaaattccaacacttagactaaactctacaatttaaaagtttaacacatgaatttaattaaatt |
2057805 |
T |
 |
| Q |
216 |
gaattgaaataattttagatcaatac |
241 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
2057806 |
gaattgaaataattttagatcaatac |
2057831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 30 - 116
Target Start/End: Original strand, 2057573 - 2057659
Alignment:
| Q |
30 |
agttttaacttcttgctattagatttagttgaaattttgttagaatcatttacagaactgttatggaagttagctagtcgttattgt |
116 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
2057573 |
agttttaacttcttgctattagatttggttgaagttttgttagaatcatttgcagaactgttatggaagttagctagtcgttattgt |
2057659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University