View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1137_low_134 (Length: 315)
Name: NF1137_low_134
Description: NF1137
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1137_low_134 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 211; Significance: 1e-115; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 83 - 315
Target Start/End: Original strand, 3160895 - 3161124
Alignment:
| Q |
83 |
gaaatgaatcaacatatttcacaaatgaacaatttatagatttctttgatggtcctgaagaagattgttgcacaattaacagcattgaatttagtaacaa |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3160895 |
gaaatgaatcaacatatttcacaaatgaacaatttatagatttctttgatggtcctgaagaagattgttgcacaattaacagcattgaatttagtaacaa |
3160994 |
T |
 |
| Q |
183 |
cagtactatcgcacaaattgactgcattacaagtagttttgaatcatgtttaactgaaaaagatgaattcatttgcaaggaaaaggaaactacatcaagt |
282 |
Q |
| |
|
||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3160995 |
cagtagt---gcacaaattgactgcattacaagtagttttgaatcatgtttaactgaaaaagatgaattcatttgcaaggaaaaggaaactacatcaagt |
3161091 |
T |
 |
| Q |
283 |
gatgaaaaagtggaagacattgaagaaaacact |
315 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |
|
|
| T |
3161092 |
gatgaaagagtggaagacattgaagaaaacact |
3161124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University