View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1137_low_142 (Length: 303)
Name: NF1137_low_142
Description: NF1137
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1137_low_142 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 203; Significance: 1e-111; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 17 - 223
Target Start/End: Original strand, 6394175 - 6394381
Alignment:
| Q |
17 |
ataggtataagagtagtccaagtagttaggacttaggaggttgagctatgaattgagtagaaacttgaaggagagcttcactcttactatttattatttt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
6394175 |
ataggtataagagtagtccaagtagttaggacttaggaggttgagctatgaattgagtagaaacttgaaggagagcttcactcttactatttcttatttt |
6394274 |
T |
|
| Q |
117 |
cttaattcaattggagaagcaattgtccaaggtcaaaacagaacactcagagcagacatgcagaagcaagtacgaaacacaggtacacatattatcaagt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6394275 |
cttaattcaattggagaagcaattgtccaaggtcaaaacagaacactcagagcagacatgcagaagcaagtacgaaacacaggtacacatattatcaagt |
6394374 |
T |
|
| Q |
217 |
taaacat |
223 |
Q |
| |
|
||||||| |
|
|
| T |
6394375 |
taaacat |
6394381 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 114 - 163
Target Start/End: Original strand, 6425794 - 6425843
Alignment:
| Q |
114 |
tttcttaattcaattggagaagcaattgtccaaggtcaaaacagaacact |
163 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
6425794 |
tttcttaattcaattggagaagcaattgtccaaggtcaaaacaaaacact |
6425843 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 128 - 185
Target Start/End: Original strand, 14819886 - 14819943
Alignment:
| Q |
128 |
tggagaagcaattgtccaaggtcaaaacagaacactcagagcagacatgcagaagcaa |
185 |
Q |
| |
|
|||||||||||| | |||||||||||||||||||||| | ||||||||||| |||| |
|
|
| T |
14819886 |
tggagaagcaataacctaaggtcaaaacagaacactcagggtagacatgcagacgcaa |
14819943 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University