View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1137_low_170 (Length: 260)
Name: NF1137_low_170
Description: NF1137
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1137_low_170 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 25 - 260
Target Start/End: Original strand, 7102533 - 7102768
Alignment:
| Q |
25 |
atctaacttataaataaagcaaaagccactaaaaacttaggcctctttgctgatagttttgcttctcgttatttattaacagcattgctcttgaaagatt |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7102533 |
atctaacttataaataaagcaaaagccactaaaaacttaggcctctttgctgatagttttgcttctcgttatttattaacagcattgctcttgaaagatt |
7102632 |
T |
|
| Q |
125 |
ggttatattgaataagagaatcacatgatcaacgatagtttggatttactctaagacaaacgtaaaatagacatgttttgatatagttacaaataatttg |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7102633 |
ggttatattgaataagagaatcacatgatcaacgatagtttggatttactctaagacaaacgtaaaatagacatgttttgatatagttacaaataatttg |
7102732 |
T |
|
| Q |
225 |
aaataaacttctgcacctcaaatgtgtagttcctat |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
7102733 |
aaataaacttctgcacctcaaatgtgtagttcctat |
7102768 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University