View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1137_low_175 (Length: 251)
Name: NF1137_low_175
Description: NF1137
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1137_low_175 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 14 - 251
Target Start/End: Original strand, 34952702 - 34952942
Alignment:
| Q |
14 |
atatctaatctaacagtttgaccataagcagttacctgaattgaattttctcnnnnnnnnnnca---ttgttctctcaacaagttcaaatatcactcata |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||| |
|
|
| T |
34952702 |
atatctaatctaacagtttgaccataagcagttacctgaattgaattttctcaaaacaaaaaaaaaattgttctctcaacaagttcaaatatcactcata |
34952801 |
T |
 |
| Q |
111 |
agatttttgcgcggtggcgtttgtaatgtatggggtctggttagcaatatccaaacgacctcactaaaactgggctttgtattttttccaacaattcagg |
210 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
34952802 |
agatttttgcgcggtggcgttggtaatgtatggggtctggttagcaatatccaaacgacctcactgaaactgggctttgtattttttccaacaattcagg |
34952901 |
T |
 |
| Q |
211 |
agaatttcagctatccacgtagataagcaaaaccgccttga |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34952902 |
agaatttcagctatccacgtagataagcaaaaccgccttga |
34952942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University