View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1137_low_176 (Length: 251)
Name: NF1137_low_176
Description: NF1137
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1137_low_176 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 29 - 187
Target Start/End: Complemental strand, 36195071 - 36194913
Alignment:
| Q |
29 |
aaaactaacatgttttcttggagatattaacggtgttgttgatgcggtgagtttttgtttagccctaatacttcaaaatgggaaaggtatgcaatttgaa |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
36195071 |
aaaactaacatgttttcttggagatattaacggtgttgttgatgcggtgagtttttgtttagccctaatacttcaaaatgggaaaggtatgcaagttgaa |
36194972 |
T |
|
| Q |
129 |
catgtatctgatacttacagttttacgatacttccaaaaaatttctcttacattagaaa |
187 |
Q |
| |
|
||||||| ||||||||||||||||| ||||||||||||||||| ||||||||||||||| |
|
|
| T |
36194971 |
catgtatttgatacttacagttttaggatacttccaaaaaattcctcttacattagaaa |
36194913 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University