View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1137_low_177 (Length: 251)
Name: NF1137_low_177
Description: NF1137
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1137_low_177 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 10 - 251
Target Start/End: Complemental strand, 2058134 - 2057893
Alignment:
| Q |
10 |
aacaatattaatagttgatgttnnnnnnncacgattaataggaatgctcgtgagtccggataacccgttcaattcaacaatccaaacaaactcaacccca |
109 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2058134 |
aacaatattaatagttgatgttaaaaaaacacgattaataggaatgctcgtgagtccggataacccgttcaattcaacaatccaaacaaactcaacccca |
2058035 |
T |
 |
| Q |
110 |
tattttacctgaacacatttaagtttgggtcaaacatgagccaatttgttctaaatttaaagtgaattggttttgataacaaatttatgattgcaaatcc |
209 |
Q |
| |
|
||||||||| |||||||||||||||| |||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2058034 |
tattttacccgaacacatttaagtttaggtcaaacatgagccaatttattctaaatttaaagcgaattggttttgataacaaatttatgattgcaaatcc |
2057935 |
T |
 |
| Q |
210 |
atgaacacatgaacttgacctgtgcagagaattgagattttt |
251 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2057934 |
acgaacacatgaacttgacctgtgcagagaattgagattttt |
2057893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University