View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1137_low_191 (Length: 235)
Name: NF1137_low_191
Description: NF1137
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1137_low_191 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 1 - 204
Target Start/End: Original strand, 36900226 - 36900429
Alignment:
| Q |
1 |
actgttttcattttgtaggaaaatggtttnnnnnnnngaaacaacacgacatagaagacccatcaaatgacaatcgtcgtccttttaattctgagaataa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36900226 |
actgttttcattttgtaggaaaatggtttaaaaaaaagaaacaacacgacatagaagacccatcaaatgacaatcgtcgtccttttaattctgagaataa |
36900325 |
T |
 |
| Q |
101 |
tctggaaggagttttgccaccaaattacaaaacctttcgcctatttgtcagatgtatatctgaactcactcttagactttttgtaggtatgtcttctcca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
36900326 |
tctggaaggagttttgccaccaaattacaaaacctttcgcctatttgtcagatgtatatctgaactcactcttagactttttggaggtatgtcttctcca |
36900425 |
T |
 |
| Q |
201 |
catt |
204 |
Q |
| |
|
|||| |
|
|
| T |
36900426 |
catt |
36900429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University