View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1137_low_206 (Length: 201)
Name: NF1137_low_206
Description: NF1137
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1137_low_206 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 187; Significance: 1e-101; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 187
Target Start/End: Original strand, 23989373 - 23989559
Alignment:
| Q |
1 |
aggaggatcggttgaatgtagtttcgatcgagggtcagtgcaatgagaatttgtatgaggatcatcacgggtggaatgatgattacaatgagtatctatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23989373 |
aggaggatcggttgaatgtagtttcgatcgagggtcagtgcaatgagaatttgtatgaggatcatcacgggtggaatgatgattacaatgagtatctatg |
23989472 |
T |
 |
| Q |
101 |
gaacggactgcacaatgagatctttgaacatgtttacagttgtttcccggtctcatctcttaaaagggtatgtcacatgatgtatat |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23989473 |
gaacggactgcacaatgagatctttgaacatgtttacagttgtttcccggtctcatctcttaaaagggtatgtcacatgatgtatat |
23989559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 64; E-Value: 3e-28
Query Start/End: Original strand, 21 - 187
Target Start/End: Original strand, 23982708 - 23982877
Alignment:
| Q |
21 |
gtttcgatcgagggtcagtgcaatgagaatttgtatgaggatcatcacgggtggaatgatgattacaatg---agtatctatggaacggactgcacaatg |
117 |
Q |
| |
|
||||| || ||||||||||| |||||||||||| ||||||| ||||| |||||||| |||||| | || || |||||||||||| ||||| ||| |
|
|
| T |
23982708 |
gtttcaattgagggtcagtggaatgagaatttgcatgaggaacatcatgggtggaacgatgatgattttgttaaggatctatggaacgcactgcctgatg |
23982807 |
T |
 |
| Q |
118 |
agatctttgaacatgtttacagttgtttcccggtctcatctcttaaaagggtatgtcacatgatgtatat |
187 |
Q |
| |
|
||| ||||||||| ||||||||||||| || |||| |||||||||||||||||||||||||||||||| |
|
|
| T |
23982808 |
agacctttgaacaattttacagttgtttaccaatctcgtctcttaaaagggtatgtcacatgatgtatat |
23982877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 111 - 176
Target Start/End: Original strand, 23965494 - 23965559
Alignment:
| Q |
111 |
cacaatgagatctttgaacatgtttacagttgtttcccggtctcatctcttaaaagggtatgtcac |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| | ||||||||||| || |||||||||||| |
|
|
| T |
23965494 |
cacaatgagatctttgaacatgtttacagttgtttctctgtctcatctctgaatagggtatgtcac |
23965559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University