View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1137_low_26 (Length: 607)
Name: NF1137_low_26
Description: NF1137
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1137_low_26 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 76; Significance: 8e-35; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 76; E-Value: 8e-35
Query Start/End: Original strand, 458 - 576
Target Start/End: Complemental strand, 36246178 - 36246063
Alignment:
| Q |
458 |
ttctacaaacttttgtattttaatttgttgtatatatatctctagcttctaataagatttaatagctttaaaaatctcagtctcacagtgatgtgatgtt |
557 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| |||||||||||||| | ||||||||||||||| |||| |||||| |||||||||||||| |
|
|
| T |
36246178 |
ttctacaaacttta-tattttaatttgttgtatatatatgtctagcttctaatagggtttaatagctttaaagatct--gtctcatagtgatgtgatgtt |
36246082 |
T |
|
| Q |
558 |
ggtgattcatgtattcctc |
576 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
36246081 |
ggtgattcatgtattcctc |
36246063 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 335 - 414
Target Start/End: Complemental strand, 36253061 - 36252981
Alignment:
| Q |
335 |
ttgtggaagtgcttgtttgcactcaagattgtctgaaagga-tctcctttctaaaacttatttgatgaggaccttgaagaa |
414 |
Q |
| |
|
||||||||||||||||||||||||||||||| || ||| || |||||||||| |||||||||||||| ||||||||||||| |
|
|
| T |
36253061 |
ttgtggaagtgcttgtttgcactcaagattgcctaaaaagaatctcctttctcaaacttatttgatggggaccttgaagaa |
36252981 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University