View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1137_low_50 (Length: 496)
Name: NF1137_low_50
Description: NF1137
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1137_low_50 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 325; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 325; E-Value: 0
Query Start/End: Original strand, 144 - 488
Target Start/End: Original strand, 7364795 - 7365139
Alignment:
| Q |
144 |
ttctgtcatccaatgcaaatgccatatagattccttagtccatcacccattacattcatcttttcctcccactataaattcttgcctcaagttaaaattt |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7364795 |
ttctgtcatccaatgcaaatgccatatagattccttagtccatcacccattacattcatcttttcctcccactataaattcttgcctcaagttaaaattt |
7364894 |
T |
 |
| Q |
244 |
gattatcaaaatcaaaattggcttcttcattttcaagtaaaaacaaattatattttcatcttataagctcataaaatggattcaaactatgcttcctcaa |
343 |
Q |
| |
|
|||||||||||||||| |||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7364895 |
gattatcaaaatcaaagttggcttctttgtattcaagtaaaaacaaattatattttcatcttataagctcataaaatggattcaaactatgcttcctcaa |
7364994 |
T |
 |
| Q |
344 |
accatggctcttcacaaagatcactagctatggttttggctttagtctcagctgttgtgttatcgcctttatatgtgaattcaaagagtgataggagata |
443 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
7364995 |
accatggctcttcacaaagatcactagctatggttttggctttagtctcagctgttgtgttatctcctttatatgtgaattcaaagagtgataggagata |
7365094 |
T |
 |
| Q |
444 |
ttatgaatcaaaatggactagctctggttttgttctacctatgat |
488 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7365095 |
ttatgaatcaaaatggactagctctggttttgttctacctatgat |
7365139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 48; Significance: 3e-18; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 97 - 148
Target Start/End: Complemental strand, 21551881 - 21551830
Alignment:
| Q |
97 |
agtgttttacggtgatttgattttaacaaccgtttttgtcccacaggttctg |
148 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
21551881 |
agtgttttacggtgatttgattttaacaactgtttttgtcccacaggttctg |
21551830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University