View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1137_low_76 (Length: 420)
Name: NF1137_low_76
Description: NF1137
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1137_low_76 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 151; Significance: 9e-80; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 151; E-Value: 9e-80
Query Start/End: Original strand, 66 - 263
Target Start/End: Original strand, 29679308 - 29679506
Alignment:
| Q |
66 |
aacaatattttggtagttcataacctgaaaaacaacttattctcagcaaatcaacttaataatggttttatttttgaatttaagttggattgttttgtta |
165 |
Q |
| |
|
||||||||||||||| | |||||||| ||||| ||||||||||||||||||||||||||||||| |||||||||||||||||| | |||||||||||||| |
|
|
| T |
29679308 |
aacaatattttggtaatccataaccttaaaaagaacttattctcagcaaatcaacttaataatgattttatttttgaatttaactcggattgttttgtta |
29679407 |
T |
|
| Q |
166 |
ttaaagattgaaatcaaaggattttaaacgaaggacataaa-aaggcaaactctatgcactgacggggaaacttttgaagctctctctactattaaaga |
263 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29679408 |
ttaaggatagaaatcaaaggattttaaacgaaggacataaacaaggcaaactctatgcattgacggggaaacttttgaagctctctctactattaaaga |
29679506 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University