View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1137_low_91 (Length: 371)
Name: NF1137_low_91
Description: NF1137
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1137_low_91 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 159; Significance: 1e-84; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 35 - 201
Target Start/End: Complemental strand, 45774446 - 45774280
Alignment:
| Q |
35 |
agaaatacatccgacttgtcgaccgatacacttggcatatgatttacgtaatttgtaaccccccgatacactcagtgctcgcccttccatcaatcatcag |
134 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45774446 |
agaaatacatccgacttgtcgcccgatacacttggcatatgatttaggtaatttgtaaccccccgatacactcagtgctcgcccttccatcaatcatcag |
45774347 |
T |
|
| Q |
135 |
acccaaccattgaaggatgccgtttgtaatggatgcaaggttagagcgttcgcaggtaccaccctta |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45774346 |
acccaaccattgaaggatgccgtttgtaatggatgcaaggttagagcgttcgcaggtaccaccctta |
45774280 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 99; E-Value: 9e-49
Query Start/End: Original strand, 256 - 362
Target Start/End: Complemental strand, 45774276 - 45774170
Alignment:
| Q |
256 |
gaatattgttttactaattttttactactcaatgtacattaaaacattattatacaatttagtagtactaaaagaaatagaatgaaagagaacaaaacaa |
355 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
45774276 |
gaatattgttttactaatttttgactactcaatgtacattaaaacattattatacaatttagtagtactaaaagaaatagattgaaagagaacaaaacaa |
45774177 |
T |
|
| Q |
356 |
gaataat |
362 |
Q |
| |
|
||||||| |
|
|
| T |
45774176 |
gaataat |
45774170 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University