View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1137_low_94 (Length: 367)
Name: NF1137_low_94
Description: NF1137
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1137_low_94 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 137; Significance: 2e-71; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 137; E-Value: 2e-71
Query Start/End: Original strand, 56 - 196
Target Start/End: Original strand, 41198155 - 41198295
Alignment:
| Q |
56 |
attattcttattgttataacatcaaaaatatatgttaactgtccatcattctctaaggtttgtgttgttgatttataagtgttgtgttattactctctct |
155 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
41198155 |
attattcttattgttataacatcaaaaatatatgttaactgtccatcattctctaaggtttgtgttgttgatttataagtattgtgttattactctctct |
41198254 |
T |
|
| Q |
156 |
atatatatgtgcatatattatgaatttatgatagtgatgaa |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41198255 |
atatatatgtgcatatattatgaatttatgatagtgatgaa |
41198295 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 60 - 196
Target Start/End: Original strand, 41208145 - 41208274
Alignment:
| Q |
60 |
ttcttattgttataacatcaaaaatatatgttaactgtccatcattctctaaggtttgtgttg-ttgatttataagtgttgtgttattactctctctata |
158 |
Q |
| |
|
|||||||||||||||||||||| ||||||| |||| |||||||||||||| |||||||||||| |||| ||||||||||||| ||||||||| || |
|
|
| T |
41208145 |
ttcttattgttataacatcaaacatatatg-taacggtccatcattctct-aggtttgtgttgtttgacttataagtgttgtcttattactc------ta |
41208236 |
T |
|
| Q |
159 |
tatatgtgcatatattatgaatttatgatagtgatgaa |
196 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
41208237 |
tatatgtatatatattatgaatttatgatagtgatgaa |
41208274 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University