View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11380_low_14 (Length: 213)

Name: NF11380_low_14
Description: NF11380
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11380_low_14
NF11380_low_14
[»] chr3 (1 HSPs)
chr3 (5-46)||(51238455-51238496)


Alignment Details
Target: chr3 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 5 - 46
Target Start/End: Original strand, 51238455 - 51238496
Alignment:
5 gaggcaaacaccttattgacaaacgaggtgtcaattctgtat 46  Q
    ||||||||||||||||||||||||||||||||||||||||||    
51238455 gaggcaaacaccttattgacaaacgaggtgtcaattctgtat 51238496  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University