View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11380_low_9 (Length: 237)
Name: NF11380_low_9
Description: NF11380
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11380_low_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 107; Significance: 9e-54; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 92 - 222
Target Start/End: Original strand, 1576927 - 1577056
Alignment:
| Q |
92 |
aaaacatttttatttacaatcaaaataataaaattgtttaactagatgcaacgtatctcataaattacaaaaggattagtattcacaattgtctaccgaa |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||| |
|
|
| T |
1576927 |
aaaacatttttatttacaatcaaaataataaaattgtttaactagatgcaacgtatctcataaatctcaaaaggattagtattcacaattgtctatagaa |
1577026 |
T |
 |
| Q |
192 |
gatacatttggttttaccaaaacggtagata |
222 |
Q |
| |
|
||||||||||| ||||||||||||||||||| |
|
|
| T |
1577027 |
gatacatttgg-tttaccaaaacggtagata |
1577056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 1 - 53
Target Start/End: Original strand, 1576877 - 1576929
Alignment:
| Q |
1 |
caaatccaaaatattacagtatgttttattatatagattttcttttttcaaaa |
53 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
1576877 |
caaatccaaaatattacagtatgttttattacatagattttcttttttcaaaa |
1576929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University