View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11381_high_38 (Length: 210)
Name: NF11381_high_38
Description: NF11381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11381_high_38 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 18 - 196
Target Start/End: Original strand, 42799229 - 42799407
Alignment:
| Q |
18 |
caagatagcattttactctgtatgcactagagttatgcagaattcatacttgacaaggttcaatgcaatgagagcttatatgatatagtacacaccttga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42799229 |
caagatagcattttactctgtatgcactagagttatgcagaattcatacttgacaaggttcaatgcaatgagagcttatatgatatagtacacaccttga |
42799328 |
T |
 |
| Q |
118 |
tgatctgttttggtgtcacaaggggaagaccaacatcagatagttccttggttccccaactttcgaaccattgatgtcc |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
42799329 |
tgatctgttttggtgtcacaaggggaagaccaacatcagatagttccttggttccccaactttcgaaccattgaagtcc |
42799407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University