View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11381_low_35 (Length: 260)
Name: NF11381_low_35
Description: NF11381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11381_low_35 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 18 - 251
Target Start/End: Original strand, 1500016 - 1500248
Alignment:
| Q |
18 |
gttaagaaccattaatgcatgacatgttctatgacgccaagttgttttcggttgtttgtttgaaaggaaaatcgattttatctcaaactttatcattaat |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
1500016 |
gttaagaaccattaatgcatgacatgttctatgacgccaagttgttt-cggttgtttgtttgaaaggaaaatcgattttatctcaaactttataattaat |
1500114 |
T |
|
| Q |
118 |
taattaacgtgtgtttatttatggtgctatcatggtgcattctttcattatccttaactcctcataaataacttaactttctaatttctcatccttgctt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
1500115 |
taattaacgtgtgtttatttatggtgctatcatggtgcattctttcattatccttaactcctcataaataacttcactttctaatttctcatccttgctt |
1500214 |
T |
|
| Q |
218 |
tgccctttcagcgatgtgttgcggttacctttgc |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
1500215 |
tgccctttcagcgatgtgttgcggttacctttgc |
1500248 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University