View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11381_low_39 (Length: 252)
Name: NF11381_low_39
Description: NF11381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11381_low_39 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 135; Significance: 2e-70; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 99 - 237
Target Start/End: Original strand, 4680253 - 4680391
Alignment:
| Q |
99 |
aattcggctcaaattgacttacgtctagaagatagagaagctctctaattcactatcaatgaattttttgcaaagagatataaggattacaagaaataac |
198 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4680253 |
aattcggctcaaattgacttacgtttagaagatagagaagctctctaattcactatcaatgaattttttgcaaagagatataaggattacaagaaataac |
4680352 |
T |
 |
| Q |
199 |
ccttcaagtcttcaaccataaaccctaatttacaccctt |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4680353 |
ccttcaagtcttcaaccataaaccctaatttacaccctt |
4680391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 4680112 - 4680201
Alignment:
| Q |
1 |
caatactatgatgtgtggag-aaaaaccaacaacaaccaaaatagtttgagcaatttaaacaaaccaaccaaattgtgtagcaaaacaaa |
89 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4680112 |
caatactatgatgtgtggagcaaaaaccaacaacaaccaaaatagtttgatcaatttaaacaaaccaaccaaattgtgtagcaaaacaaa |
4680201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 139 - 195
Target Start/End: Complemental strand, 22097981 - 22097925
Alignment:
| Q |
139 |
ctctctaattcactatcaatgaattttttgcaaagagatataaggattacaagaaat |
195 |
Q |
| |
|
||||||||| |||||||||||| |||||| |||| ||||| |||| ||| ||||||| |
|
|
| T |
22097981 |
ctctctaatccactatcaatgagttttttacaaatagatacaagggttataagaaat |
22097925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University