View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11381_low_48 (Length: 212)
Name: NF11381_low_48
Description: NF11381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11381_low_48 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 35; Significance: 0.00000000007; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 60 - 98
Target Start/End: Complemental strand, 51238434 - 51238396
Alignment:
| Q |
60 |
ataataataaacaaaacatgataaacacacgaagacatt |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
51238434 |
ataataataaacaaaacatgataaacacactaagacatt |
51238396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University