View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11381_low_48 (Length: 212)

Name: NF11381_low_48
Description: NF11381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11381_low_48
NF11381_low_48
[»] chr3 (1 HSPs)
chr3 (60-98)||(51238396-51238434)


Alignment Details
Target: chr3 (Bit Score: 35; Significance: 0.00000000007; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 60 - 98
Target Start/End: Complemental strand, 51238434 - 51238396
Alignment:
60 ataataataaacaaaacatgataaacacacgaagacatt 98  Q
    |||||||||||||||||||||||||||||| ||||||||    
51238434 ataataataaacaaaacatgataaacacactaagacatt 51238396  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University