View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11382_high_22 (Length: 302)

Name: NF11382_high_22
Description: NF11382
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11382_high_22
NF11382_high_22
[»] chr5 (3 HSPs)
chr5 (19-79)||(38055466-38055526)
chr5 (112-155)||(38055436-38055479)
chr5 (259-302)||(38055305-38055348)


Alignment Details
Target: chr5 (Bit Score: 61; Significance: 3e-26; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 19 - 79
Target Start/End: Complemental strand, 38055526 - 38055466
Alignment:
19 aaatgttttcaatttgtcaagtaatcgaagcacattatgtcgaaatagaaaagtaattgaa 79  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38055526 aaatgttttcaatttgtcaagtaatcgaagcacattatgtcgaaatagaaaagtaattgaa 38055466  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 112 - 155
Target Start/End: Complemental strand, 38055479 - 38055436
Alignment:
112 gaaaagtaattgaagcactgaattttgtgtcaacatagaataat 155  Q
    ||||||||||||||||||||||||||||||||||||||||||||    
38055479 gaaaagtaattgaagcactgaattttgtgtcaacatagaataat 38055436  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 259 - 302
Target Start/End: Complemental strand, 38055348 - 38055305
Alignment:
259 ctaacttatatctttatgacactcgttagtaagacactcccctt 302  Q
    ||||| ||||| ||||||||||||||||||||||||||||||||    
38055348 ctaacctatatttttatgacactcgttagtaagacactcccctt 38055305  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University