View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11382_high_22 (Length: 302)
Name: NF11382_high_22
Description: NF11382
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11382_high_22 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 61; Significance: 3e-26; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 19 - 79
Target Start/End: Complemental strand, 38055526 - 38055466
Alignment:
| Q |
19 |
aaatgttttcaatttgtcaagtaatcgaagcacattatgtcgaaatagaaaagtaattgaa |
79 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38055526 |
aaatgttttcaatttgtcaagtaatcgaagcacattatgtcgaaatagaaaagtaattgaa |
38055466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 112 - 155
Target Start/End: Complemental strand, 38055479 - 38055436
Alignment:
| Q |
112 |
gaaaagtaattgaagcactgaattttgtgtcaacatagaataat |
155 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38055479 |
gaaaagtaattgaagcactgaattttgtgtcaacatagaataat |
38055436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 259 - 302
Target Start/End: Complemental strand, 38055348 - 38055305
Alignment:
| Q |
259 |
ctaacttatatctttatgacactcgttagtaagacactcccctt |
302 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
38055348 |
ctaacctatatttttatgacactcgttagtaagacactcccctt |
38055305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University