View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11382_high_24 (Length: 300)
Name: NF11382_high_24
Description: NF11382
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11382_high_24 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 88; Significance: 3e-42; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 187 - 286
Target Start/End: Original strand, 20640883 - 20640982
Alignment:
| Q |
187 |
gagacaaattcgccagttgtagtcgtcgatgtgtcttcgtgggatatccttatggacaaaagggatggagagtttatgacattgagactcatgaattctt |
286 |
Q |
| |
|
|||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
20640883 |
gagaaaaattcgccagtcgtagtcgtcgatgtgtcttcgtgggatatccttatggacaaaagggatggagagtttatgacattgagactcttgaattctt |
20640982 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 72; Significance: 9e-33; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 72; E-Value: 9e-33
Query Start/End: Original strand, 6 - 253
Target Start/End: Original strand, 33157861 - 33158108
Alignment:
| Q |
6 |
agtttgccccttgatttttggggtgagtgtgtcttgacagcaggatacttgattaaccgcactccaagctccattttaaaaggaaagaccccatatgaag |
105 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||||||||||||| ||||||||||| || ||||||||||| || || || || || || || || |||| |
|
|
| T |
33157861 |
agtttgcccattgatttttggggtgagtgtatcttgacagcagggtacttgattaatcgtactccaagctcaatattgaatgggaaaactccgtacgaag |
33157960 |
T |
|
| Q |
106 |
tgttgcatggaaaaccaccctcatatgctcatttatgtatttttggatctttgtgttttgcacgcaaccaaaatacgaacggagacaaattcgccagttg |
205 |
Q |
| |
|
| ||||| |||||||||||||| || |||| || | || ||||| || || |||| ||| |||||||| |||||| ||||||||||| | ||| | |
|
|
| T |
33157961 |
tattgcacggaaaaccaccctcttacactcacctacgcatatttggttcattatgttatgcgtgcaaccaaggtacgaaaggagacaaattttcaagtcg |
33158060 |
T |
|
| Q |
206 |
tagtcgtcgatgtgtcttcgtgggatatccttatggacaaaagggatg |
253 |
Q |
| |
|
|||||| ||||||||||| |||||||||||||| ||||| ||||| |
|
|
| T |
33158061 |
cagtcgtaagtgtgtcttcgtaggatatccttatggccaaaaaggatg |
33158108 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University