View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11382_low_17 (Length: 346)
Name: NF11382_low_17
Description: NF11382
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11382_low_17 |
 |  |
|
| [»] scaffold0103 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: chr7 (Bit Score: 103; Significance: 3e-51; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 184 - 286
Target Start/End: Complemental strand, 12808432 - 12808330
Alignment:
| Q |
184 |
tatcaagaagtaattgccataaacaacatcaactccaagaatcacaaacccttatgcttgacaaccaagaaacctgcagaagaagatgagaaacataatc |
283 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12808432 |
tatcaagaagtaattgccataaacaacatcaactccaagaatcacaaacccttatgcttgacaaccaagaaacctgcagaagaagatgagaaacataatc |
12808333 |
T |
 |
| Q |
284 |
agt |
286 |
Q |
| |
|
||| |
|
|
| T |
12808332 |
agt |
12808330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 1 - 53
Target Start/End: Complemental strand, 12808617 - 12808565
Alignment:
| Q |
1 |
tttgcaacttaatcacagcttattgcatttgtctcaacattttgcaattgtct |
53 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12808617 |
tttgcaacttaatcacagcttattgcatttgtctcaacattttgcaattgtct |
12808565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 1 - 53
Target Start/End: Original strand, 37433390 - 37433442
Alignment:
| Q |
1 |
tttgcaacttaatcacagcttattgcatttgtctcaacattttgcaattgtct |
53 |
Q |
| |
|
||||||||||||||||| |||||| | ||||||||||||| |||||||||||| |
|
|
| T |
37433390 |
tttgcaacttaatcacaacttattacttttgtctcaacatcttgcaattgtct |
37433442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 103; Significance: 3e-51; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 184 - 286
Target Start/End: Original strand, 2634152 - 2634254
Alignment:
| Q |
184 |
tatcaagaagtaattgccataaacaacatcaactccaagaatcacaaacccttatgcttgacaaccaagaaacctgcagaagaagatgagaaacataatc |
283 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2634152 |
tatcaagaagtaattgccataaacaacatcaactccaagaatcacaaacccttatgcttgacaaccaagaaacctgcagaagaagatgagaaacataatc |
2634251 |
T |
 |
| Q |
284 |
agt |
286 |
Q |
| |
|
||| |
|
|
| T |
2634252 |
agt |
2634254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 1 - 53
Target Start/End: Original strand, 2633967 - 2634019
Alignment:
| Q |
1 |
tttgcaacttaatcacagcttattgcatttgtctcaacattttgcaattgtct |
53 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2633967 |
tttgcaacttaatcacagcttattgcatttgtctcaacattttgcaattgtct |
2634019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 1 - 53
Target Start/End: Original strand, 12083787 - 12083839
Alignment:
| Q |
1 |
tttgcaacttaatcacagcttattgcatttgtctcaacattttgcaattgtct |
53 |
Q |
| |
|
|||||||||||||||||||||||| | ||||||||||||| |||||||||||| |
|
|
| T |
12083787 |
tttgcaacttaatcacagcttattacttttgtctcaacatcttgcaattgtct |
12083839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0103 (Bit Score: 99; Significance: 8e-49; HSPs: 2)
Name: scaffold0103
Description:
Target: scaffold0103; HSP #1
Raw Score: 99; E-Value: 8e-49
Query Start/End: Original strand, 184 - 286
Target Start/End: Complemental strand, 5857 - 5755
Alignment:
| Q |
184 |
tatcaagaagtaattgccataaacaacatcaactccaagaatcacaaacccttatgcttgacaaccaagaaacctgcagaagaagatgagaaacataatc |
283 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
5857 |
tatcaagaagtaattgccataaacaacatcaactccaagaatcacaaacccttatgcttgacaaccaagaaacctgcagaagaagttgagaaacataatc |
5758 |
T |
 |
| Q |
284 |
agt |
286 |
Q |
| |
|
||| |
|
|
| T |
5757 |
agt |
5755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0103; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 1 - 53
Target Start/End: Complemental strand, 6042 - 5990
Alignment:
| Q |
1 |
tttgcaacttaatcacagcttattgcatttgtctcaacattttgcaattgtct |
53 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6042 |
tttgcaacttaatcacagcttattgcatttgtctcaacattttgcaattgtct |
5990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 52; Significance: 9e-21; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 194 - 285
Target Start/End: Original strand, 4638118 - 4638209
Alignment:
| Q |
194 |
taattgccataaacaacatcaactccaagaatcacaaacccttatgcttgacaaccaagaaacctgcagaagaagatgagaaacataatcag |
285 |
Q |
| |
|
|||||| |||||||| || ||||||| ||||||||||| |||||||||||| |||||||||||||||||||||||| | ||||||| |||| |
|
|
| T |
4638118 |
taattgacataaacagcaccaactcccagaatcacaaaaccttatgcttgatgaccaagaaacctgcagaagaagataaaaaacatactcag |
4638209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 8 - 51
Target Start/End: Original strand, 4637951 - 4637994
Alignment:
| Q |
8 |
cttaatcacagcttattgcatttgtctcaacattttgcaattgt |
51 |
Q |
| |
|
|||||||||| |||||||| |||||||||| ||||||||||||| |
|
|
| T |
4637951 |
cttaatcacaacttattgcttttgtctcaagattttgcaattgt |
4637994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 37; Significance: 0.000000000008; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 1 - 53
Target Start/End: Complemental strand, 21838146 - 21838094
Alignment:
| Q |
1 |
tttgcaacttaatcacagcttattgcatttgtctcaacattttgcaattgtct |
53 |
Q |
| |
|
|||||||||||||||||||||||| | ||||| ||||||| |||||||||||| |
|
|
| T |
21838146 |
tttgcaacttaatcacagcttattacttttgtgtcaacatattgcaattgtct |
21838094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 53
Target Start/End: Original strand, 4807075 - 4807127
Alignment:
| Q |
1 |
tttgcaacttaatcacagcttattgcatttgtctcaacattttgcaattgtct |
53 |
Q |
| |
|
|||||||||| |||||| |||||| | ||||| ||||||| |||||||||||| |
|
|
| T |
4807075 |
tttgcaacttgatcacaacttattacttttgtgtcaacatattgcaattgtct |
4807127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 40
Target Start/End: Original strand, 27896812 - 27896851
Alignment:
| Q |
1 |
tttgcaacttaatcacagcttattgcatttgtctcaacat |
40 |
Q |
| |
|
|||||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
27896812 |
tttgcaacttaatcacagcttattacttttgtctcaacat |
27896851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University