View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11382_low_30 (Length: 275)
Name: NF11382_low_30
Description: NF11382
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11382_low_30 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 124; Significance: 8e-64; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 124; E-Value: 8e-64
Query Start/End: Original strand, 113 - 257
Target Start/End: Complemental strand, 39983928 - 39983784
Alignment:
| Q |
113 |
cttcttaaatattggcaaattttggaatcttattgnnnnnnngcaagtcatagatttataaatcattgatgaatggctaatgtgagtgacaaattataaa |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39983928 |
cttcttaaatattggcaaattttggaatcttattgtttttttgcaagtcatagatttataaatcattgatgaatggctaatgtgagtgacaaattataaa |
39983829 |
T |
 |
| Q |
213 |
tcataactttatagattcttttgttgaatttctcctcgggatcca |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39983828 |
tcataactttatagattcttttgttgaatttctcctcgggatcca |
39983784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 1 - 46
Target Start/End: Complemental strand, 39984041 - 39983996
Alignment:
| Q |
1 |
tgatgaggtttacacgcaggttgctttgcttccacaggcagaggta |
46 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
39984041 |
tgatgaggtttacacacaggttgctttgcttccacaggcagaggta |
39983996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University