View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11382_low_34 (Length: 253)
Name: NF11382_low_34
Description: NF11382
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11382_low_34 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 17 - 238
Target Start/End: Original strand, 24892647 - 24892868
Alignment:
| Q |
17 |
agaattttgatagagtttcctatgtgtttacattgaatatcagagtctctgactcagtcaacctaacacaaactaacagacaaaatattttcacaacata |
116 |
Q |
| |
|
||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
24892647 |
agaattttggcagagtttcctttgtgtttacattgaatatcagagtctctgactcagtcaacctaacacaaactcacagacaaaatattttcacaacata |
24892746 |
T |
 |
| Q |
117 |
gtatctcagtcatttttaaattttaatgttggcggtgtcagcagtcacttcatgctctacctcaaacatcctttatttcaaaaattcattcttcgttgga |
216 |
Q |
| |
|
| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
24892747 |
gcatctcagtcatttttaaattttaatgttggcagtgtcagcagtcacttcatgctctacctcaaacgtcctttatttcaaaaattcattcttcattgga |
24892846 |
T |
 |
| Q |
217 |
acatcgcaaatcataggttcat |
238 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
24892847 |
acatcgcaaatcataggttcat |
24892868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University