View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11382_low_37 (Length: 249)
Name: NF11382_low_37
Description: NF11382
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11382_low_37 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 12 - 249
Target Start/End: Complemental strand, 3639779 - 3639544
Alignment:
| Q |
12 |
atgaaaagtgaatacaagaattatgcttcacaatagtcaactggggagaccctagcacaaagggaggaactttcccaccaccgaaagcactttgaaagta |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3639779 |
atgaaaagtgaatacaagaattatgcttcacaatagtcaactggggagaccctagcacaaagggaggaactttcccaccaccgaaagcactttgaaagta |
3639680 |
T |
 |
| Q |
112 |
gatatcggaaacagacagtttttgtgctgtctgaaggtgtatttcagacaaaaacacgannnnnnnctctgtgcagatgtgtatttccggaatcctgtgc |
211 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
3639679 |
gatatcggaaac--acagtttttgtgctgtctgaaggtgtatttcagacaaaaacacgatttttttctctgtgcagatgtgtatttccggaatcctgtgc |
3639582 |
T |
 |
| Q |
212 |
ggnnnnnnnaggacctcagcctcctatgtagcctacta |
249 |
Q |
| |
|
|| ||||||||||||||||||||||||||||| |
|
|
| T |
3639581 |
ggtttttttaggacctcagcctcctatgtagcctacta |
3639544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University