View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11382_low_38 (Length: 249)
Name: NF11382_low_38
Description: NF11382
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11382_low_38 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 233
Target Start/End: Complemental strand, 9214029 - 9213800
Alignment:
| Q |
1 |
tattgttgtaagtgcatgagattatgcatgttattttcaagtactccaacttaattcatctgccaatgtaaattaatgttgttgtttttgcagggttgtc |
100 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||| |
|
|
| T |
9214029 |
tattgttgtaagtgcatgagattatgtatgttattttcaagtactccaacttaattcatctgctaatgtaaattaatgttattgtttttgcagggttgtc |
9213930 |
T |
 |
| Q |
101 |
agcttgggaaaaggtctatgatggctgctactgacttgttagctgctgtaagcatttcttctttcaattgctaatatttacagtgcaatagttgattgct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||| | |
|
|
| T |
9213929 |
agcttgggaaaaggtctatgatggctgctactgacttgttagctgctgtaagcatttcttctttcaattgctaatatttacattgcagtagttgat---t |
9213833 |
T |
 |
| Q |
201 |
gcagttgaaaaaagtttcctagtttgtttgact |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
9213832 |
gcagttgaaaaaagtttcctagtttgtttgact |
9213800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University