View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11382_low_42 (Length: 247)
Name: NF11382_low_42
Description: NF11382
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11382_low_42 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 6 - 231
Target Start/End: Complemental strand, 28406417 - 28406190
Alignment:
| Q |
6 |
agacgatcacgacgaagggccacgttgagaagtgaatcaagatgacaattattttatgatagaatgtttgctattcaattttgattacaactatactaag |
105 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
28406417 |
agacgatcacgacaaagggccacgttgagaagtggatcaagatgactattattttatgatagaatgtttgctattcagttttgattacaactatactaag |
28406318 |
T |
 |
| Q |
106 |
ttattgtttactactagaatccatacatttaa--tagggttttcattttctggatatttgttgcatgctgtgttgtgattttctaatggcatggacaaaa |
203 |
Q |
| |
|
|| |||||||| |||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
28406317 |
ttcttgtttacaactagaatccatacatttaatctaggattttcattttctggatatttgttgcatgctgtgttgtgattttctaattgcatggacaaaa |
28406218 |
T |
 |
| Q |
204 |
tgcatattttggtttagaacgttgctat |
231 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
28406217 |
tgcatattttggtttagaacgttgctat |
28406190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University