View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11382_low_47 (Length: 239)
Name: NF11382_low_47
Description: NF11382
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11382_low_47 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 219; Significance: 1e-120; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 3639558 - 3639336
Alignment:
| Q |
1 |
ctatgtagcctactaattttatggtttcaccttcactgtgacgtccaacaaatttgtacatgatcttatgatttgctcactttgagacttcgcctagctt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3639558 |
ctatgtagcctactaattttatggtttcaccttcactgtgacatccaacaaatttgtacatgatcttatgatttgctcactttgagacttcgcctagctt |
3639459 |
T |
 |
| Q |
101 |
taggcctcaacttgcctcgccctacaacttatgatgctcatgcagaagaattaatcgaccatactttatcaaagtgaaatatatgcttccgcacacggaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3639458 |
taggcctcaacttgcctcgccctacaacttatgatgctcatgcagaagaattaatcgaccatactttatcaaagtgaaatatatgcttccgcacacggaa |
3639359 |
T |
 |
| Q |
201 |
cacatggatgcagtagaggtatg |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
3639358 |
cacatggatgcagtagaggtatg |
3639336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 117 - 219
Target Start/End: Complemental strand, 3648164 - 3648062
Alignment:
| Q |
117 |
tcgccctacaacttatgatgctcatgcagaagaattaatcgaccatactttatcaaagtgaaatatatgcttccgcacacggaacacatggatgcagtag |
216 |
Q |
| |
|
|||||| |||||||| || | ||||| |||||||||| |||||| ||| ||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
3648164 |
tcgccccacaacttacgacgatcatgtagaagaattacgacaccatagtttgtcaaagtgaaaaatatgcttccgcacgcggaacacatggatgcagtag |
3648065 |
T |
 |
| Q |
217 |
agg |
219 |
Q |
| |
|
||| |
|
|
| T |
3648064 |
agg |
3648062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University