View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11382_low_55 (Length: 210)
Name: NF11382_low_55
Description: NF11382
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11382_low_55 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 19 - 195
Target Start/End: Original strand, 47050470 - 47050647
Alignment:
| Q |
19 |
gaaatgtgtgcaagtcatcgagataaaatatatagggtgtcacgtgtctatattttgacgttcaaataacacaatcataaattaaaagatgcttgtgttt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47050470 |
gaaatgtgtgcaagtcatcgagataaaatatatagggtgtcacgtgtctatattttgacgttcaaataacacaatcataaattaaaagatgcttgtgttt |
47050569 |
T |
|
| Q |
119 |
ttcttaagttcatattatattagagattcg-aacctagggaggtgtttccatcactcttttgtctcttcttatctgtg |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47050570 |
ttcttaagttcatattatattagagattcgaaacctagggaggtgtttccatcactcttttgtctcttcttatctgtg |
47050647 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 62 - 94
Target Start/End: Complemental strand, 16764395 - 16764363
Alignment:
| Q |
62 |
gtgtctatattttgacgttcaaataacacaatc |
94 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |
|
|
| T |
16764395 |
gtgtatatattttgacgttcaaataacacaatc |
16764363 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University