View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11382_low_56 (Length: 204)
Name: NF11382_low_56
Description: NF11382
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11382_low_56 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 19 - 190
Target Start/End: Original strand, 52112502 - 52112673
Alignment:
| Q |
19 |
tgtcactcttccgccatttgatttaacaacagatcgaatctcttctgctaatttacggtgtagattaacaccaccacgtccaatccacttcaacaaatta |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52112502 |
tgtcactcttccgccatttgatttaacaacagatcgaatctcttctgctaatttacggtgtagattaacaccaccacgtccaatccacttcaacaaatta |
52112601 |
T |
|
| Q |
119 |
ggnnnnnnnntcttcatcccaccaaatgaattaaaacatgtggcaaataaaagattatgaaccgcttcttct |
190 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52112602 |
ggaaaaaaaatcttcatcccaccaaatgaattaaaacatgtggcaaataaaagattatgaaccgcttcttct |
52112673 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 130 - 178
Target Start/End: Original strand, 6533302 - 6533350
Alignment:
| Q |
130 |
cttcatcccaccaaatgaattaaaacatgtggcaaataaaagattatga |
178 |
Q |
| |
|
||||||||| ||||| |||||||||||||| || ||||| ||||||||| |
|
|
| T |
6533302 |
cttcatcccgccaaacgaattaaaacatgttgcgaataatagattatga |
6533350 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University