View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11383_low_7 (Length: 375)
Name: NF11383_low_7
Description: NF11383
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11383_low_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 307; Significance: 1e-173; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 307; E-Value: 1e-173
Query Start/End: Original strand, 12 - 326
Target Start/End: Complemental strand, 19390810 - 19390496
Alignment:
| Q |
12 |
agagaagaaaggaattgacaactctgcccttctcaacaattaggtttatgactcatattaggttaatacttgtgtgaaaagatttttgaatcgaagatga |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19390810 |
agagaagaaaggaattgacaactctgcccttctcaacaattaggtttatgactcatattaggttaatacttgtgtgaaaagatttttgaatcgaagatga |
19390711 |
T |
 |
| Q |
112 |
gtaatgaggaggaagagaaggaaaagaaaatttgttcagtggtagttgaaaaagtaggaggcagatcatcagttataacctgcttatctagatatcctct |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19390710 |
gtaatgaggaggaagagaaggaaaagaaaatttgttcagtggtagttgaaaaagtaggaggcagatcatcagttataacctgcttatctagatatcctct |
19390611 |
T |
 |
| Q |
212 |
caagtttatcatacctaaaaaggtttttattttcaacaatcgtctgttttatgcttatgctgtggaatgatcatcattggttagaaaatattgactttgc |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||| |
|
|
| T |
19390610 |
caagtttatcatacctaaaaaggtttttattttcaacaatcgtctgttttatgcttatgctgtggagtgatcattattggttagaaaatattgactttgc |
19390511 |
T |
 |
| Q |
312 |
aagtttgcatgacac |
326 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
19390510 |
aagtttgcatgacac |
19390496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University