View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11385A_high_25 (Length: 249)
Name: NF11385A_high_25
Description: NF11385A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11385A_high_25 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 16 - 249
Target Start/End: Original strand, 54877398 - 54877632
Alignment:
| Q |
16 |
aacggttgttcatggttctccggtgtggcggaggttgaatcttcaagatggaggagtgcagacatattaacactccaacgctcaagtcaatatttgtggt |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
54877398 |
aacggttgttcatggttctccggtgtggcggaggttgaatcttcaaggtggaggagtgcagacatattaacactccaacgctcaagtcagtatttatggt |
54877497 |
T |
 |
| Q |
116 |
tatgtgcagaagtgtaccttgagggtg-cgttgaatcatccttatatagacgtagagagcgctaacggttcccgcaaagtgtggcgcaatcttaggaggt |
214 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||| ||||||||||||| ||||||||||||||||||||| |||| |
|
|
| T |
54877498 |
tatgtgcagaagtgtaccttgagggtgtcgttgaatcatccttatatagatgtagagagtgctaacggttcccacaaagtgtggcgcaatcttagaaggt |
54877597 |
T |
 |
| Q |
215 |
cgttagagattacgtggacggtggagatgtagtca |
249 |
Q |
| |
|
||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
54877598 |
cgttagagattacgtggacggtggatatggagtca |
54877632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 72 - 104
Target Start/End: Original strand, 18322943 - 18322975
Alignment:
| Q |
72 |
tgcagacatattaacactccaacgctcaagtca |
104 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
18322943 |
tgcagacatgttaacactccaacgctcaagtca |
18322975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University