View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11385A_high_37 (Length: 213)
Name: NF11385A_high_37
Description: NF11385A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11385A_high_37 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 127; Significance: 9e-66; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 127; E-Value: 9e-66
Query Start/End: Original strand, 23 - 192
Target Start/End: Complemental strand, 35154498 - 35154331
Alignment:
| Q |
23 |
catcatacctgtatagtcttagagtctcttgtatttttgtgtgaatttagttcgttcatatgtgtccctttgtttataagcttttagtagctgctctttg |
122 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||| ||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
35154498 |
catcatacctgtatagtcttagggtctcttgtatttttgtgtgaatttagttcattcat--gtgtctctttgtttataagcttttagtagctgctctttg |
35154401 |
T |
 |
| Q |
123 |
tacgttttttatgtatcgacgatcactccttgtgctcgtcagtatcaagccttacgtacatattcgaatt |
192 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| ||||||||||||||| |||||||| |||||| |||| |
|
|
| T |
35154400 |
tacgttttttatgtattgacgatcactccttgtcctcgtcagtatcaagtcttacgtatatattcaaatt |
35154331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University